Substrate Requirements for Telomere Resolution

Next, the substrate requirements for telomere resolution in vitro were examined (Tourand et al. 2003). This work was guided by an alignment of all the telomeres sequenced at that time from B. burgdorferi, B. afzelii and B. hermsii (Casjens 1999, and references therein). From that alignment it is apparent that all the sequenced telomeres share five boxes of homology, accounting for 14 bp of the terminal 23 bp. Starting from this foundation the minimal size of an rTel derived from the left telomere of plasmid lp17 (Hinnebusch and Barbour 1991) was determined to be 38 bp from 19 bp in the unreplicated hp telomere form. Systematic introduction of transversions at each of the 14 conserved base pairs within the model lp17 rTel identifies box 3 as especially important for resolution (see Fig. 3). Box 3 is located 15-19 bp from the symmetry axis of the rTel and is in the position that normally directs sequence-specific binding of tyrosine recombi-nases to their respective sites. Full-length ResT does not bind its substrate in a gel-shift assay (other than by aggregation) but the C-terminal domain, as defined by partial protease digestion (aa~160-449), contains the tyrosine recombinase-like domain and the part of ResT required for site recognition. Box 3-5 sequences are sufficient for the site-specific gel shift

—ATATAATTTTTTATTAGTATAGA ,p17 L_end ^—TATATTAAAAAATAATCATATCT (typel)

.—tAaaTATaATTTAATAGTATAAA B31 chromosome L-end —aTttATAtTAAATTATCATATTT ^P®2)

.—AAATTAGTTTTTTTTAGTATAAA sh-2-82 chromosome R-end — T T T AAT C AAAAAAAAT C AT AT T T ^P®3)

Fig. 3 The three types of hp telomeres in B. burgdorferi. A representative of each type is shown and the conserved sequence boxes are shaded and numbered. Positions with known sequence variability within box 1 or near the hp turnaround are indicated in lower case. The arrows indicate the position of cleavage by ResT. This is not yet determined for the type 3 telomere, so the expected position of cleavage is indicated with a "?" mark. Adapted from Chaconas (2005) with permission from Blackwell Publishing seen with the isolated C-terminal domain (Tourand and Chaconas 2007; Jayaram 2007).

Another feature highlighted by the alignment of the known hp telomeres is the existence of two types of hp telomere that differ by the spacing of the box 1 sequence relative to the symmetry axis and to boxes 3-5. A third telomere type without any discernable box 1 has been described (Huang et al. 2004b) and is designated as a type 3 telomere (see Fig. 3 for a summary of the telomere types). The existence of multiple telomere types raises the possibility that there may be a requirement for more than one telomere resolving activity. Types 1 and 2 and many different substrates in which the disposition of box 1 relative to boxes 3-5 and the symmetry axis were constructed and assayed for resolution by ResT in vitro. ResT was found to efficiently process only the type 1 and type 2 spacing variants (Tourand et al. 2003). This result presented somewhat of a conundrum since in the type 1 rTel the scissile phosphates lay within box 1, while for the type 2 substrate the position of the cleavage sites would have to move from being 6 to 12 bp apart if box 1 sequences defined the position of cleavage (see Fig. 3). The position of the cleavage sites in the type 2 and a further poorly resolved spacing variant map to 6 bp apart around the symmetry axis of the rTel, indicating that site-specific binding of ResT to boxes 3-5, whose position relative to the symmetry axis remains fixed, positions the active sites for catalysis. Nonetheless, replacement of box 1 sequences in either the type 1 or type 2 substrates leads to a defect of activity in vitro. Mutation of the same sequence, which occurs in the otherwise unrelated sequence of the substrate for the N15 resolvase, TelN, also results in defective resolution; this indicates that the box 1 sequence is important for resolution in both systems (Deneke et al. 2002). Nevertheless, a type 3 rTel is also resolved in vitro, indicating that mutation of the telomere to the particular sequence found at the corresponding box 1 position is tolerated (Tourand et al. 2006). It may prove to be the case that any sequence around the cleavage site with the appropriate helical parameters for cross-axis complex formation and DNA hairpin formation (see Sect. 5.7) may be tolerated and that box 1 sequences are conserved at some telomeres as part of a promoter element (Chaconas 2005). Clearly, more hp telomeres must be sequenced and the role of the box 1 sequences given further study.

0 0

Post a comment