Determination of the Sex of Embryos or EG Cell Lines by PCR for Zfy Gene

1. Lysis buffer, 100 mM EDTA, 50mM Tris-HCl, pH 8.0, 100 mM NaCl, 1% SDS. Proteinase K should be added at 0.5 mg/mL immediately before use. Proteinase K (Sigma cat. no. P2308) is made up in water at 10 mg/mL, self-digested at 37°C for 60 min and stored in aliquots at -20°C.

2. Oligonucleotide primers. 5'-primer AAGATAAGCTTACATAATCACATGGA, 3'-primer CCTATGAAATCCTTTGCTGCACATGT. A stock solution of these primers is 100 \\M and should be kept frozen in aliquots at -20°C. Oligonucleotides can be purchased from Operon Technologies (510-865-8644).

3. 10X PCR buffer, 100 mM Tris-HCl, pH 8.3, 500 mM KCl, 25 mM MgCl2, 0.1% gelatin. Store frozen at -20°C.

4. dNTPs (Pharmacia 1-800-526-3593, cat. no. 27-2035-01). The purchased dNTP stock is 100 mM and should be kept frozen at -20°C. 10X working solution 10 mM each dNTP) is made by combining 10 \L of each of the four stocks and adding 60 \L of water.

5. Taq polymerase (Stratagene 1-800-424-5444, TaqPlus™ DNA Polymerase cat. no. 600203). As with any enzyme, Taq should be stored at -20°C in a nonfrost-free freezer.

Was this article helpful?

0 0

Post a comment