Blk

627 629 blk

Fig. 1. RNA dot blots used to eliminate cell lines that produce intron-containing fusion transcripts. Duplicate RNA dot blots containing 10 |g total RNA were hybridized with lacZ and intron probes of the gene trap vector. 433 is a typical example of an intron-containing cell line.

3.3.3. RACE Cloning

The following protocol has been streamlined and contains a number of modifications to the original method described by Frohman, et al. (ref. 14). The most important of these are:

1. Alkaline hydrolysis of the RNA (required for efficient T-tailing with terminal deoxytransferase);

2. Synthesis of second-strand cDNA with Klenow instead of Taq polymerase; and

3. The use of microdialysis filters, which serves a dual role of removing primers/ buffers between steps and size-selecting informative cDNA fragments above 300 bp in length.

By way of example, Table 1 lists the oligos used for RACE cloning from cell lines obtained with the pGT1.80geo and pGT1.8TM vectors.

1. Spin down 5-10 |g of total RNA in an Eppendorf tube, wash RNA pellet twice with 70% ethanol, and partially dry pellet in Speed Vac. Repeat this step, since it is important to remove any residual urea. Resuspend RNA sample on ice in 10 |L of DEPC-treated water. Add 1 ||L of 10 ng/|L primer 1, and heat for 5 min at 70°C. Cool on ice and spin briefly.

2. Set up first-strand reaction by adding:

1 |L of Superscript II RT.

Incubate first-strand reaction at 37°C for 1 h.

3. To improve the efficiency of the tailing reaction, hydrolyze RNA by adding 2.2 |L of 1 M sodium hydroxide for 20 min at 65°C. Neutralize with 2.2 |L of 1 M hydrochloric acid.

Table 1

Primer Combinations Used in 5' RACEa

Primer Gene trap vector, pGT1.8geo Secretory trap vector, pGT1.8tm

1 5' TAATGGGATAGGTTACG 5' CCAGAACCAGCAAACTGAAGGG

2 5' GGTTGTGAGCTCTTCTAGATGG(T)17 5' GGTTGTGAGCTCTTCTAGATGG(T) 17

3 5' GGTTGTGAGCTCTTCTAGATGG 5' GGTTGTGAGCTCTTCTAGATGG

4 5' ATTCAGGCTGCGCAACTGTTGG 5' AGTAGACTTCTGCACAGACACC

5 5' TGCTCTGTCAGGTACCTGTTGG 5' TGCTCTGTCAGGTACCTGTTGG

aXbal and Kpnl sites used in cloning the RACE products are underlined.

4. Microdialyze sample on a 0.025-|im filter floating in a Petri dish of TE for 4 h. Transfer the remainder of the sample to an Eppendorf tube, and wash the filter with water to bring the final volume to 20 ||L.

5. Set up tailing reaction by adding 6 ||L of TdT buffer (5X) and 2 |L of 2 mM dATP. Incubate for 2 min at 37°C. Add 2 |L of TdT enzyme, and incubate for a further 5 min. Stop the reaction by heating to 70°C for 2 min.

6. Carry out second-strand synthesis by adding the following to 15 |L of tailed cDNA:

2 |L restriction buffer M (10X). 1 |L dNTPs (10 mM). 1 |L primer 2 (10 ng/mL). 1 |L Klenow enzyme. Incubate for 30 min at room temperature, 30 min at 37°C, and 5 min at 70°C.

7. Microdialyze for 4 h on a 0.1-|im filter. Recover cDNA from filter into a final volume of 37 ||L of H2O.

8. For the first-round PCR reaction, add the following to 37 |L of sample:

5 |L 10X AmpliTaq buffer

1 |L primer 3 (100 ng) 1 |L primer 4 (100 ng) 1 |L AmpliTaq Carry out 30 cycles using the following parameters: Denature 94°C for 1.5 min

Anneal 60°C for 1.5 min

Extend 72°C for 3.0 min

9. Microdialyze for 4 h on a 0.1-|im filter to remove smaller, uninformative PCR products and excess primers. Recover sample from filter.

10. Perform second-round PCR using 5 |L of the first-round PCR reaction and:

5 |L PCR buffer

1 |L primer 3 (100 ng/mL) 1 |L primer 5 (100 ng/mL) 1 |L AmpliTaq 37 | L H2O

Use same cycle parameters as first-round PCR, but use a hot start. After the final cycle, polish the second-round PCR products by adding 50 ng of each primer, 0.5 |L of dNTPs, and 0.5 |L of Amplitaq. Perform one cycle using the following conditions: Denature 94°C for 1.5 min

Anneal 60°C for 1.5 min

Extend 72°C for 20.0 min

11. Microdialyze for 4 h on a 0.1-|im filter, and recover sample from filter. Analyze 5 | L of sample by gel electrophoresis and Southern blot hybridization (see Note 5). Digest the remainder of the sample with XbaI and KpnI.

12. Following digestion, extract the sample twice with phenol/chloroform, extract once with chloroform, and precipitate the RACE products on ice for 10 min by adding 5 |g of glycogen, 25 |L of 10 M ammonium acetate, and 300 |L of etha-nol. Microfuge for 10 min, wash pellet with 70% ethanol, partially dry pellet in Speed Vac and resuspend in 20 |L of TE.

13. Ligate 100-200 ng of Xbal/KpnI-digested RACE products with 50-100 ng XbaI/ KpnI-digested plasmid DNA in a final volume of 15 mL at room temperature for at least 2 h:

4-8 |L Digested PCR products (100-200 ng) 1 |L Digested plasmid DNA (100 ng) 1.5 |L Ligation buffer (10X) 1 |L T4 DNA ligase 3.5-7.5 |L H2O

14. Transform into competent bacteria, and screen colonies for desired inserts (see Note 6).

Was this article helpful?

0 0

Post a comment