Dna Polymerase Binds To Template

FIGURE 24.03 Synthesis of DNA—Priming and Elongation

During normal DNA synthesis, DNA polymerase reads the template strand and makes a new complementary strand of DNA. To get DNA synthesis started, a short oligonucleotide primer must anneal to the 3' end of the template. DNA polymerase recognizes the 3' end of the primer and adds incoming nucleotides to the 3' end, hence synthesis occurs in a 5' to 3' direction.

Template strand

3' ACGGCTATTA DNA CGCTGCAATGCTTCGGAAACA 5'

Dna polymerase adds nucleotides to end of primer

Template strand

3' ACGGCTATTAACTGTCGGCG DNA CTTCGGAAACA 5'

polymerase

Primer

FIGURE 24.04 Synthesis of

DNA—Phosphodiester

Bonding

DNA poly merase links nucleotides via phosphodiester bonds. When adding another nucleotide, DNA polymerase breaks the bond between the first and second phosphates of the deoxynucleoside triphosphate. The incoming nucleotide is then joined to the free 3' hydroxyl of the growing DNA chain.

Growing DNA chain

Growing DNA chain will join at 3' position

HO H

will join at 3' position

HO H

Was this article helpful?

0 0

Post a comment