Ii

(b) Drosophila GTCACATAG I- 264 bp-1 TGATTATTTGATGACCGAAA

▲ FIGURE 10-33 Comparison of yeast CEN sequence and Drosophila simple-sequence DNA. (a) Consensus yeast CEN sequence, based on analysis of 10 yeast centromeres, Includes three conserved regions. Region II, although variable in sequence, is fairly constant in length and is rich in A and T

residues. (b) One Drosophila simple-sequence DNA located near the centromere has a repeat unit with some homology to the yeast consensus CEN, including two identical 4-bp and 6-bp stretches (red). [See L. Clarke and J. Carbon, 1985, Ann. Rev Genet. 19:29.]

Single-stranded DNA at terminus of telomere

Catalytic site for dNTP addition

^CCCc

Catalytic site for dNTP addition

Telomerase-associated RNA template

Telomerase-associated RNA template

Reverse transcription catalyzed by telomerase to position 35 of RNA template

Dissociation of 3' end of DNA and base pairing to a downstream region of > 'telomerase RNA

aCCCC44

aCCCC44

Reverse transcription to position 35

Translocation and hybridization c

10 Ways To Fight Off Cancer

10 Ways To Fight Off Cancer

Learning About 10 Ways Fight Off Cancer Can Have Amazing Benefits For Your Life The Best Tips On How To Keep This Killer At Bay Discovering that you or a loved one has cancer can be utterly terrifying. All the same, once you comprehend the causes of cancer and learn how to reverse those causes, you or your loved one may have more than a fighting chance of beating out cancer.

Get My Free Ebook


Post a comment