Plasmids

The genetic system comprises two plasmid components. One plasmid expresses the lacZ reporter mRNA bearing an RNA target sequence just upstream of the S/D region, and the other expresses the RNA-BP that binds this RNA target. The plasmids have compatible origins of replication, ensuring that residence of either plasmid will not interfere with the replication of the other when both plasmids are present in the same cell. The plasmids described in Sections IV,B,1 and IV,B,2, which were used for our studies of Rev, encode either the Rev protein or lacZ mRNA containing the Rev target, RRE stem-loop IIB (Jain and Belasco, 1996). Protocols for making new plasmids that encode a different RNA-BP and its corresponding RNA target are also described in these sections.

1. RNA-BP Plasmid

The RNA-BP expressing plasmid, pREVl, confers resistance to chloramphenicol and contains a Rev gene expressed from a strong A1 promoter (PA1) that is repressible by the Lac repressor (Fig. 2). Transcription of the Rev gene initiates at bp 2560 and proceeds in a clockwise direction. The Rev coding region starts at bp 2627 and ends at bp 2974. Important restriction sites are unique Ndel and Clal sites close to the start of the Rev coding region, as well as a Sail site (bp 2984) and a unique Bsu36l site (bp 2989) just downstream of the Rev coding region (a second Sail site is present within the Rev coding region). Translation begins at an initiation codon (ATG) 15 bp upstream of the Ndel site and adds a short peptide sequence (MRGSIH) to the amino terminus of Rev.

To express a different RNA-BP from pREVl, the Rev gene can be excised as a restriction fragment flanked upstream by an Ndel or Clal end and downstream

CTCGAGAAAATTTATCAAAAAGAGTGTTGACTTGTGAGCGGATAACAATGATACTTAGATTCA Xho I lac operator transcription start _

AATTGTGAGCGGATAACAATTTGAATTCATTAAAGAGGAGAAATTAACTATGAGAGGATCGATCCATATG

^ lac operator ^ »D Initiation C/a| Ndel codon

Figure 2 Plasmid for RNA-BP expression in E. coli. The plasmid pREVl contains a P15A origin of replication derived from pACYC184 (Rose, 1988) and a cat gene that confers resistance to chloramphenicol. An fl phage replication origin also present is useful for producing single-stranded plasmid DNA in vivo. Important restriction sites are indicated; each is unique except for the Sail site.

The sequence of the plasmid region controlling transcription and translation of the RNA-BP gene is shown above the plasmid map. This region, downstream of the Xhol site, includes the —35 and -10 regions of the PA1 promoter and the lac operator sites that make the promoter repressible by the Lac repressor. Downstream of the transcription initiation site are the S/D region and the RNA-BP initiation codon. The Rev-coding region starts at the ATG codon within the Ndel site and extends for 116 codons, ending with two tandem termination codons. Downstream of the termination codons are Sail and Bsu36l sites. The amino acid sequence of a short peptide preceding the native Rev sequence (MRGSIH) is shown, and the unique Ndel and Clal restriction sites that map to this region are indicated.

Figure 2 Plasmid for RNA-BP expression in E. coli. The plasmid pREVl contains a P15A origin of replication derived from pACYC184 (Rose, 1988) and a cat gene that confers resistance to chloramphenicol. An fl phage replication origin also present is useful for producing single-stranded plasmid DNA in vivo. Important restriction sites are indicated; each is unique except for the Sail site.

The sequence of the plasmid region controlling transcription and translation of the RNA-BP gene is shown above the plasmid map. This region, downstream of the Xhol site, includes the —35 and -10 regions of the PA1 promoter and the lac operator sites that make the promoter repressible by the Lac repressor. Downstream of the transcription initiation site are the S/D region and the RNA-BP initiation codon. The Rev-coding region starts at the ATG codon within the Ndel site and extends for 116 codons, ending with two tandem termination codons. Downstream of the termination codons are Sail and Bsu36l sites. The amino acid sequence of a short peptide preceding the native Rev sequence (MRGSIH) is shown, and the unique Ndel and Clal restriction sites that map to this region are indicated.

by a Bsw36I or Sail end and can be replaced by a compatible fragment encoding another RNA-BP in the proper reading frame for translation. Because the Clal site of pREVl is methylated in most E. coli strains by Dam methylase, digestion with Clal requires prior propagation of the plasmid in dam~ cells. DNA inserts encoding other RNA-BPs are most readily prepared by polymerase chain reaction (PCR), using an upstream primer that creates an NdeI site (CATATG) or a Clal-compatible site (e.g., Clal, Narl, ftp14061, BsiBI, certain Accl sites) at or near the RNA-BP start codon and a downstream primer that creates a Bsu36l site (CCTCAGG) or a -Sail-compatible site (e.g., Sali, Xhol) downstream of the RNA-BP stop codon. An advantage of amplifying the insert fragment by PCR is that a short epitope tag can be incorporated simultaneously at the amino or carboxyl terminus of the RNA-BP, which could prove useful in analyzing RNA-BPs for which antibodies are unavailable.

Expression of a heterologous RNA-BP may be toxic to E. coli cells. Until the possibly toxic effects of an RNA-BP have been investigated, expression of the RNA-BP should be minimized to avoid inadvertently selecting for mutations that may affect the RNA-binding properties or expression of the protein in E. coli. When constructing the multicopy plasmid for expression of the RNA-BP, this can best be accomplished by transforming the ligation mixture into WM1/F' or an equivalent strain containing a lacP gene. Overproduction of the LacI protein (Lac repressor) will ensure that transcription from the RNA-BP promoter is repressed. Selection for transformants containing the RNA-BP expression plasmid is achieved by adding chloramphenicol (35 ^tg/ml) to the growth medium.

2. Reporter Plasmid

The plasmid pLACZ-IIB is a pUC19 derivative conferring ampicillin resistance (Fig. 3). It encodes an IS 10—lacZ fusion gene, which is transcribed clockwise starting at bp 81. The weak IS 10 translation initiation signals ensure that lacZ expression is kept at a low level (Jain and Kleckner, 1993), which is a sensitive range for screening for changes in )3-galactosidase activity. Upstream of the initiation codon is a weak S/D sequence preceded by stem-loop IIB, the human immunodeficiency virus type 1 (HIV-1) RNA target recognized by Rev. Farther upstream are other important elements, such as an IS 10 promoter and a T7 RNA polymerase promoter useful for synthesizing transcripts in vitro. These are preceded by signals for blocking transcriptional and translational readthrough.

Replacement of stem-loop IIB with a different RNA target can be conveniently achieved by oligonucleotide-directed mutagenesis. The plasmid pLACZ-IIB has an fl replication origin, which allows the production of single-stranded DNA needed for some mutagenesis protocols (Kunkel et al., 1991; Olsen et al, 1993). The mutagenic oligonucleotide should be complementary to the sense

Transcriptional startpoint

RRE stem-loop IIB

GCUAGACUAGUCUAGCGAACCGCACUUAAUACGACUCACUAUAGGUAC GAUUCAGACAACAAGAUG...

Translation terminators

T7 RNA polymerase promoter

Kpn I

Initiation codon

Figure 3 Reporter plasmid for lacZ expression. The plasmid pLACZ-lIB contains an IS 10-lacZ gene fusion consisting of the first 63 codons of the rs 10 transposase gene fused at the Hindlll site to the ninth codon of lacZ (fain and Kleckner, 1993). The plasmid also contains a ColEl replication origin, a bla gene conferring resistance to ampicillin, and an fl replication origin useful for the production of single-stranded plasmid DNA. A set of four tandem transcriptional terminators derived from the E. coli rrnB operon precedes the sequences important for expression of lacZ.

The RNA sequence of the 5' untranslated region of the IS iO—lacZ reporter transcript is shown above the plasmid map. Within this RNA sequence are translation termination codons (UAG) in all three reading frames, a T7 RNA polymerase promoter, RRE stem-loop IIB, and the IS i 0 S/D element and initiation codon. Stem—loop IIB is boxed; formation of this stem—loop has been reinforced by the addition of two extra base pairs. The Kpnl site preceding stem-loop IIB is useful when PCR is employed to introduce sequences that encode new RNA targets. Although this Kpnl site is not unique in pLACZ-IIB, a related plasmid, pLACZ-UlhpII, contains a unique Kpnl site at this position and can be used for cloning PCR products encoding new RNA targets.

Figure 3 Reporter plasmid for lacZ expression. The plasmid pLACZ-lIB contains an IS 10-lacZ gene fusion consisting of the first 63 codons of the rs 10 transposase gene fused at the Hindlll site to the ninth codon of lacZ (fain and Kleckner, 1993). The plasmid also contains a ColEl replication origin, a bla gene conferring resistance to ampicillin, and an fl replication origin useful for the production of single-stranded plasmid DNA. A set of four tandem transcriptional terminators derived from the E. coli rrnB operon precedes the sequences important for expression of lacZ.

The RNA sequence of the 5' untranslated region of the IS iO—lacZ reporter transcript is shown above the plasmid map. Within this RNA sequence are translation termination codons (UAG) in all three reading frames, a T7 RNA polymerase promoter, RRE stem-loop IIB, and the IS i 0 S/D element and initiation codon. Stem—loop IIB is boxed; formation of this stem—loop has been reinforced by the addition of two extra base pairs. The Kpnl site preceding stem-loop IIB is useful when PCR is employed to introduce sequences that encode new RNA targets. Although this Kpnl site is not unique in pLACZ-IIB, a related plasmid, pLACZ-UlhpII, contains a unique Kpnl site at this position and can be used for cloning PCR products encoding new RNA targets.

strand, and the 3' boundary of the RNA target sequence should be placed immediately adjacent to the S/D sequence to increase the chances of achieving high-level translational repression.

Another way to introduce a new RNA target is through PCR cloning, taking advantage of the Kpnl site immediately preceding the pLACZ-IIB sequence corresponding to stem—loop IIB. Although pLACZ-IIB has two Kpnl sites, a derivative of this plasmid (pLACZ-UlhpII; Jain and Belasco, 1996) contains a unique Kpnl site. Thus, PCR amplification can be performed on pLACZ-IIB or pLACZ-UlhpII using a forward primer that has the sequence 5' NNNGGTACC-minimal RNA target sequence-AGACAACAAGATGTGCGAACTCG 3' and a reverse primer (5' CGACGGGATCGATCCCCCC 3') that is complementary to a sequence immediately downstream of the unique Hi«dIII site of the template. The ~0.25-kb PCR product is then digested with Kpnl and Hindlll and subcloned between the corresponding sites of pLACZ-UlhpII. Note that pLACZ-UlhpII does not carry a binding site for Rev, and translation of its lacZ transcript is not repressed by pREVl.

The ligation mixture is transformed into WM1 and plated on LB medium containing ampicillin (100 jug/ml) and X-Gal (60 /U-g/ml). Plasmid DNA from blue or light blue colonies, indicative of lacZ expression, can then be tested for the incorporation of the desired RNA targets.

Was this article helpful?

0 0

Post a comment