Red Cell Blood Groups

4.1 Terminology

The terminology used for antigens is that recommended by the Working Party on Terminology for Red Cell Surface Antigens of the International Society of Blood Transfusion (ISBT) (Daniels et al 1995, 1996, 1999). This Working Party has categorized over 250 different blood group antigens Into Systems, Collections, Low Incidence Antigens, and High Incidence Antigens. The terminology is inconsistent. A single letter (e.g., A, D, K), a symbol and a superscript (e.g., Fy'1, Fyb, JkJ), and a numerical notation (e.g., Fy 3, Lu 4, K 11) are used even within the same system (e.g., Fya, Fy3). A blood group 'system' consists of one or more antigens controlled by a single gene locus, or by two or more closely linked homologous genes with little or no observable recombination between them.

4.2 Clinical Applications

Blood group antigens have relevance in transfusion medicine because people whose cells lack an antigen can be alloimmunized if they are exposed to the corresponding antigen. This can occur in the setting of transfusion or fetal-maternal incompatibility, and alloantibodies can cause destruction of antigen-positive RBCs in vivo. Classical haem-agglutlnation is specific, sensitive, quick to perform, and Inexpensive but has limitations. Molecular analysis can be used to overcome these serological limitations.

Table 4.1

Red cell blood group systems

Table 4.1

Red cell blood group systems

Blood Group System

Gene Name

Molecular protocols provided

Classical

ISBT No.

ISBT Symbol

ISBT

HGM

ABO

001

ABO

ABO

ABO

MNS

002

MNS

MNS

GYP A

MNS i/MNS 2

GYPB

MNS 3/MNS 4

P

003

PI

PI

PI

Rh

004

RH

RH

RHD

RH !

RHCE

RH 3/RH 5

Lutheran

005

LU

LU

LU

LU 1/LU 2

Kelt

006

KEL

KEL

KEL

KEL 1/KEL 2

KEL 6/KEL7

Lewis *

007

LE

LE

FUT3

Duffy

008

FY

FY

DARC

FY I/FY 2 GATA1;

nt265; nt298

Kidd

009

JK

JK

SLC14A1

JK 1/jK 2

Diego

010

DI

Dl

SCL4A1

Yt

011

YT

YT

ACHE

Xg

012

XG

XG

XG

Scianna

013

SC

SC

SC

Dombrock

014

DO

DO

DO

Colton

015

CO

CO

AQP1

Landsteiner-Wiener

016

LW

LW

LW

Chido/Rodgers*

017

CH/RG

CH/RG

C4A, C4B

Hh

018

H

H

FUTI

Kx

019

XK

XK

XK

Gerbich

020

GE

GE

GYP C

Cromer

021

CROM

CROM

DAF

Knops

022

KN

KN

CR1

Indian

023

IN

IN

CD44

Ok

024

OK

OK

CD147

Raph

025

RAPH

MER2

MER2

" Lewis and Chido/Rogers are not included in section 4.5

" Lewis and Chido/Rogers are not included in section 4.5

4.2.1 Identification of a Fetus at Risk for Anaemia of the Neonate (Haemolytic Disease of the Newborn (HDN))

Haemagglutination studies, including antibody titres, give only an indirect measure of potential complications for HDN. Molecular geno-typing overcomes the serological limitation to predict at-risk pregnancies for HDN. Sufficient DNA can be prepared from amniocytes obtained from routine amniocentesis as early as 13 weeks gestation. Fetal DNA can also be obtained from chorionic villi, cervical smear, or maternal plasma, thereby avoiding invasive procedures (Bennett et al 1993, 1995; Kingdom et al 1995; Lo et al 1998).

We recommend that the decision to perform molecular analyses for clinical use be based on the following:

• Mother has an alloantibody of potential clinical significance for HDN.

• Father is heterozygous for the allele or is unknown.

• DNA genotyping and RBC phenotyping is performed on the parents. This will limit the gene pool and can identify variants that could influence the interpretation of results from the fetus.

• The ethnicity of the parents is obtained. This can help focus the test approach because some variants are restricted to certain populations. For example, in black Africans, FY 2 in tandem with a mutation in GATA1 causes non-translation of the Fyb protein in the erythroid lineage (Chaudhuri et al 1995; Tournamille et al 1995; Iwamoto et al 1996).

• The results are validated by antigen typing the baby's RBCs.

4.2.2 Determination of the Presence or Absence of Blood Group Alleles in Recently Transfused Patients

DNA can be obtained from WBCs in the patient's peripheral blood, or from cells obtained by non-invasive procedures such as buccal smear and urine sediment (Rios et al 1999). We have observed that the WBCs remaining in transfused blood products (Wenk and Chiafari 1997; Lee et al 1995; Adams et al 1992) do not affect the assays given here (Reid et al 1999a). Cross-contamination between blood samples through probing on clinical automated machines is unlikely to be detected unless more sensitive methods are used (Reed et al 1997; Cheung et al 1997; Lee et al 1996).

4.2.3 Determination of Blood Group Alleles when Patients' RBCs are Coated with Immunoglobulin

Molecular genotyping is helpful if a method used to remove the antibody from RBCs denatures the target antigen (e.g., the acid elution method destroys antigens in the Kell blood group system (Julleis et al 1992)) or when a chemical treatment does not remove sufficient IgG to give confident results. This is especially true when only weakly reactive antibodies are available.

4.2.4 Resolution of A, B and D Typing Discrepancies

RBCs that express weak subgroups of A or B can result in blood group typing discrepancies. This occurs when an altered gene encodes for a transferase that adds low levels of an A (or B) immunodominant sugar to the precursor H antigen. Since the molecular bases of many of the weak subgroups of A and B are associated with altered transferase genes, PCR-RFLP can be used to define the transferase gene and, thus, the ABO group.

Anti-D reagents contain monoclonal antibodies that detect small and specific parts of the D antigen. Some donors and patients who in the past have typed as D-negative are now typed as D-positive. This occurs when monoclonal antibodies detect epitopes that were not detected by polyclonal reagents. Genotyping can identify the molecular basis for these apparent discrepancies.

4.2.5 Screening for Antigen-negative Blood Donors

Genotyping is useful when antisera are weakly reactive or are not available in sufficient quantity to screen large numbers of donor samples. However, mass screening of blood donors will be possible when DNA microchip or similar technology is available for genotyping in a rapid, throughput system (Schafer and Hawkins 1998).

4.2.6 RHD Zygosity

RHD zygosity assessment by phenotypic analysis provides only a 'most probable' genotype for the D-positive individual with other possible genotypes including both homozygous and hemizygous haplotypes. Since the D-negative genotype is generally characterized by the absence of RHD, quantitative PCR amplification of the RHD and RHCE (Protocol 3.15) can be used to determine whether the genome of a D-positive individual has one or two copies of the RHD. Table 4.2 provides exon 7 and exon 10

primers used to assess genomic DNA for RHD zygosity. The assay uses densitometry scanning of PCR amplified fragments separated by gel electrophoresis. However, it is important to note that other detection systems could be developed (e.g. fluorescent PCR amplification).

Table 4.2

Rh primers for RHD zygosity assessment (Bennettetal 1994)

Table 4.2

Rh primers for RHD zygosity assessment (Bennettetal 1994)

Primer name

Region

Gene

homology

Sequence (5' to 3')

RHD

RHCE

Rh7s

Exon 7

TGTGTTGTAACCGAGT

Yes

Yes

Rl-Ta

Exon 7

ACATGCCATTGCCG

Yes

Yes

Rh 10s

Exon 10

TAAGCAAAAGCATCCA

Yes

Yes

RhDa

3' UTR

ATGGTGAGATTCTCCT

Yes

No

UTR, untranslated region.

UTR, untranslated region.

4.3 Situations where Genotype and Phenotype do not Agree

There are several situations where genotype and phenotype results are apparently discrepant (Reid et al 1999b). Some are listed below.

• Chronic/massive transfusions where the phenotype of the patient's RBC sample may be that of transfused RBCs.

• Changes in the gene that affect either its transcription (e.g., point mutation in GATA1 of FY), splicing (point mutation of splice motif, e.g., JK, GYPA), introduction of a stop codon (e.g., RHD, FY, CO, GYPC, DAF), or stability of the membrane protein (e.g., point mutation in CO).

• Crossovers and other gene rearrangements (e.g., RHCE/RHD, GYPA/GYPB).

• Changes in a modifying gene (e.g., IN(LU), IN(JK))

• Changes in a different gene whose product is required for proper expression of the protein carrying the blood group antigen in the RBC membrane (e.g., 4.1 and Gerbich antigens; RHAG and Rh antigens; GYPA and Wrb antigen; XK and Kell antigens).

• Medical procedures, e.g., transplantation with homologous stem cells, artificial insemination or surrogate motherhood.

Occasionally, blood group genotyping may not correlate with the pheno-type in instances when there is no evidence of recent transfusion or transplantation. Both allele-specific multiplex PCR (Protocol 3.17) and Southern analysis (Protocol 3.18) are useful techniques for studying gene structure anomalies. Allele-specific multiplex PCR can provide a quick and easy 'snapshot' of the presence or absence of mutated or variant alleles (see Table 4.3 for ABO, and Table 4.4 for Rh). On the other hand, using several restriction enzymes and various 5' or 3' gene-specific probes in Southern analysis, it may be possible to identify genetic alterations to a gene (e.g., inversions, deletions, insertions). Information for the RH loci is available, although virtually any gene locus could be analysed once labelled probes have been obtained. Table 4.5 provides a list of RH primers used to obtain probes for hybridization in Southern analysis.

Table 4.3

Allele-specific primers for ABO multiplex PCR amplification (Gassner et al 1996)

Table 4.3

Allele-specific primers for ABO multiplex PCR amplification (Gassner et al 1996)

Allele

Sense primer (5' to 3')

Antisense primer (5' to 3')

O1

TTAAGTGGAAGGATGTCCTCGTCGTA

ATATATATGGCAAACACAGTTAACCCAATG

Non-O'

TAAGTGGAAGGATGTCCTCGTCGTG

Oz

AGTGGACGTGGACATGGAGTTCC

TCGACCCCCCGAAGAAGCT

non-O'

CGACCCCCCGAAGAAGCC

B

ATCGACCCCCCGAAGAGCG

non-B

CCGACCCCCCGAAGAGCC

A'

GAGGCGGTCCGGAAGCG

GGGTGTGATTTGAGGTGGGGAC

non-A2

GAGGCGGTCCGGAACACG

Control

TG CCTTCCCA A CCATTCCCTTA

CCACTCACGGATTTCTGTTGTGTTTC

Table 4.4

Allele-specific primers for RHD multiplex PCR amplification (Maaskant-van Wijk et al 1998). Correction (Primer Exon 6) Maaskant-van Wijk et al 1999

Table 4.4

Allele-specific primers for RHD multiplex PCR amplification (Maaskant-van Wijk et al 1998). Correction (Primer Exon 6) Maaskant-van Wijk et al 1999

Region

Sense primer (5' to 3')

Antisense primer (5' to 3')

Exon 3

TCGGTGCTGATCTCAGTGGA

ACTGATGACCATCCTCATGT

Exon 4

CACATGAACATGATGCACA

CAAACTGGGTATCGTTGCTG

Exon 5

GTGGATGTTCTGGCCAAGTT

CACCTTGCTGATCTTACC

Exon 6

GTGGCTGGGCTGATCTACG

TGTCTAGTTTCTTACCGGCAAGT

Exon 7

AGCTCCATCATGGGCTACAA

ATTGCCGGCTCCGACGGTATC

Exon 9

AACAGGTTTGCTCCTAAATATT

AAACTTGGTCATCAAAATATTTAACCT

Table 4.5

PCR amplification primers for hybridization probes used in Southern analysis (Hyland et al 1994;Denomme et al 1999)

Table 4.5

Region

Sense primer (5' to 3')

Antiseme primer (5' to 3')

Rh UTR -

GATCTGTTCCTTGCTTTTCTTACAAGG

CTCTAAGGAAGCGTCATAGTGGGTAAA

exon 1

RHD

ACGATACCCAGTTTGTCT

TCACCCTCAGATCGCTGT

exons 4-5

RHD cxon

TAAGCAAAAGCATCCA

ATGGTGAGATTCTCCÏ

10 - UTR

Adams, P.T., Davenport, R.D., Reardon, D.A., et al (1992) Detection of circulating donor white blood cells in patients receiving multiple transfusions. Blood 80, 551-555.

Bennett, P.R., Le Van Kim, C., Colin, Y., et al (1993) Prenatal determination of fetal RhD type by DNA amplification. N Engl J Med 329, 607-610.

Bennett, P.R., Overton, T.G., Lighten, A.D., et al (1995) Rhesus D typing, l.ancet 345, 661-662.

Chaudhuri, A., Polyakova, J., Zbrzezna, V., et al (1995) The coding sequence of Duffy blood group gene in humans and simians: Restriction fragment length polymorphism, antibody and malarial parasite specificities, and expression in non-erythroid tissues in Duffy-negative individuals. Blood 85, 615-621.

Cheung, M.-C., Goldberg, J.D. and Kan, W.K. (1997) Prenatal diagnosis of sickle cell anemia and thalassaemia by analysis of fetal cells in maternal blood. Nature Genet 14,264-268.

Daniels, G.L., Anstee, D.J., Cartron, J.-P., et al (1995) Blood group terminology 1995. ISBT working party on terminology for red cell surface antigens. Vox Sang 69, 265-279.

Daniels, G.L., Anstee, D.J., Cartron, J.P., et al (1996) Terminology for red cell surface antigens - Makuhari report. Vox Sa?ig 71, 246-248.

Daniels, G.L., Anstee, D.J., Cartron, J.P., et al (1999) Terminology for red cell surface antigens - Oslo report. Vox Sang 77, 52-57.

Denomme, G.A., Akoury, H., Sermer, M., et al (1999) RhD status of a fetus at risk for haemolytic disease with a discrepant maternal DNA-based RhD genotype. Prenat Diagn 19, 424-427.

Gassner, C., Schmarda, A., Nussbaumer, "W., et al (1996) ABO glycosyltransferase geno-typing by polymerase chain reaction using sequence-specific primers. Blood 88, 1852-1856.

Hyland, C.A., Wolter, L.C., Liew, Y.W., et al (1994) A Southern analysis of Rh blood group genes: association between restriction fragment length polymorphism patterns and Rh serotypes. Blood 83, 566-572.

Iwamoto, S., Li, J., Sugimoto, N., et al (1996) Characterization of the Duffy gene promoter: Evidence for tissue-specific abolishment of expression in Fy(a-b-) of black individuals. Biochem Biophys Res Commun 222, 852-859.

Julleis, J., Sapp, C. and Kakaiya, R. (1992). Glycine-EDTA as a substitute for AET in the inactivation of Kell system antigens on red blood cells. Abstract. Transfusion 32(Suppl), 14S.

Kingdom, J., Sherlock, J., Rodeck, C., et al (1995) Detection of trophoblast cells in transcervical samples collected by lavage or cytobrush. Obstet Gynecol 86, 283-288.

Lee, T.-H., Donegan, E., Slichter, S., et al (1995) Transient increase in circulating donor leukocytes after allogeneic transfusions in immunocompetent recipients compatible with donor cell proliferation. Blood 85, 1207-1214.

Lee, T.-H., Paglieroni, T., Ohro, H., et al (1996). Longterm multi-lineage chimerism of donor leukocytes in transfused trauma patients. Abstract. Blood 88 (Suppl 1), 265a.

Lo, Y.M.D., Hjelm, N.M., Fidler, C., et al (1998) Prenatal diagnosis of fetal RhD status by molecular analysis of maternal plasma. N Engl ] Med 339, 1734-1738.

Maaskant-van Wijk, P.A., Faas, B.H., De Ruijter, J.A., et al (1998) Genotyping of RHD by multiplex polymerase chain reaction analysis of six RHD-specific exons. Transfusion 38, 1015-1021. Maaskant-van Wijk et al (1999) Correction. Transfusion 39, 546.

Reed, W., Lee, T.-H., Busch, M.P., et al (1997). Sample suitability for the detection of minor leukocyte populations by polymerase chain reaction (PCR). Abstract. Transfusion 37 (Suppl), 107S.

Reid, M.E., Rios, M., Powell, V.I., et al (1999a) DNA from blood samples can be used to genotype patients who have been recently transfused. Transfusion, in press.

Reid, M.E., Rios, M. and Yazdanbakhsh, K. (1999b) Applications of molecular biology techniques to transfusion medicine. Semtn Hematol, in press.

Rios, M., Cash, K., Strupp, A., et al (1999) DNA from urine sediment or buccal cells can be used for blood group molecular genotyping. lmmunohematology 15, 61-65.

Schafer, A.J. and Hawkins, J.R. (1998) DNA variation and the future of human genetics. Nat Biotechnol 16, 33-39.

Tournamille, C., Colin, Y., Cartron, J.P., et al (1995) Disruption of a GATA motif in the Duffy gene promoter abolishes erythroid gene expression in Duffy-negative individuals. Nature Genet 10, 224-228.

Wenk, R.E. and Chiafari, F.A. (1997) DNA typing of recipient blood after massive transfusion. Transfusion 37, 1108-1110.

4.5 Facts Sheets, Gene Maps and Molecular Protocols

ABO Blood Group System Facts Sheet

ISBT Gene Name: Organization: Chromosome: Gene product:

7exons distributed over >18 kbp (cDNA -1,580 bp) 9q34.1-q34.2

A: al -3-N-acetyl-D-galactosaminyltransferase (353 amino acids)

B: al-3-D-galactosaminyltransferase (353 amino acids)

GenBank Accession: AFI 34412-44; D82825-28

ATG 12'982 STOP

Figure 4.1 ABO gene. For correlation of restriction enzymes and selected alleles, see Table 4.6. *Most variants are encoded by missense mutations in exon 7; see Tables 4.7, 4.8, 4.9.

Alleles: ABO 1/ABO 2 and numerous variants

Antigens: A, B and numerous subtypes

Prevalence of gene products (% based on phenotyping):

Phenotype

Caucasians

Blacks

Asians

A

40

27

28

B

11

20

27

AB

4

4

4

0

45

49

41

Molecular Details Table 4.6

Correlation of restriction enzymes and selected alleles

Allele detected

Exon

Nucleotide mutation

Restriction endonuclease

O'"'

4

188G>A; 189C>T

BsiUI

O1, O1™

6

261G deleted

Kpn I

A2, 0\ cis-AB

7

467C>T

Hpa II

B, O2

7

526C>T

Njr I/BssH II

A\ O1™

7

646T>A

Mho I

B

7

703G>A

A lu IIHap II

A\ O1"'

7

771 C>T

Dde I

A!

7

871G>A

Sa/1

B, O2

7

1096G>A

Hpa II

Ad, 0>

7

798G inserted

AS-PCR

A2, O-'

7

1059C deleted

AS-PCR

For corresponding amino acids, see Tables 4.7 to 4.9.

For corresponding amino acids, see Tables 4.7 to 4.9.

Table 4.7

A alleles

Phcnotype Allele Other Name

nt: 261 46~ 526 564 641 646 657 669 681 703 721 771 796 802 803 ^98-804 829 871 930 1009 1054 1059-1061

aa: - - [56 l"6 - 214 216 - 223 - 235 - - 266 267 268 - 2"" 291 - 337 3S2

G A C C C T T C G G G C C C G G GGGGGGG G G G G G CCG Pro Arg Met Phe Gin Gly Leu Gly Gly Val Asp Arg

Leu Arg

Leu V

Leu Gly

Asn lie

Leu He

Gly Ser Met

Leu Ala

Os-AB A

ABO A70/ ABO A102 ABO A103 ABO A104 ABO A lOS ABO A106 ABO A107 ABO All1

ABO A WS ABO A109 ABO A1I0 ABO RW1 ABO CWI

t Deletion of nt 1059(C) and then an extra 21 aa.

Table 4.8

Balleies

Exon 6

Exon 7

nt: 261

297

46"

526

564

641

646

657

669 681

703 721 771

796

802

803

798-804 829

8"1

930

1054

10 59-1061 1096

Phcnoiype

Allele

' Name

aa: -

-

156

176

-

214

216

-

223 -

2.55 -

266

26"

268

27"

291

-

552

-

Ai

ABO Alm

C,

A

c:

c:

C

-

T

C

G G

G c c:

C

G

G

GGGGGGÜ G

c;

g

c:

ex: c G

Pro

Arg

Phe

Gl li

Gly

Leu

Gly

Gly

Val

Asp

Arg

Os-AB

ABO cwi

-

-

-

Leu

-

-

-

-

-

-

-

-

-

Ala

-

-

-

-

-

B

ABO BlOt

-

-

g

-

GIv

-

-

-

T

-

Ser

A Met

-

Ala

-

-

A

-

-

B

ABO Bf02

-

-

c;

-

Gly

-

-

-

T

-

Ser

A Met

-

Ala

-

-

-

-

-

B

ABO BIO>

-

-

G

-

Gly

-

-

-

-

-

Ser

A Met

-

Ala

-

-

A

-

-

B

ABO BIO7

-

-

G

-

Gly

-

-

-

T

-

Ser

A Met

-

Ala

-

-

A

-

-

»x

ABO BI04

-

-

G

-

G Gly

-

-

-

t

-

Ser

Met

-

Ala

-

Asn

A

-

-

Bd

ABO B1 OS

-

-

(,

-

G

-

G

-

T

-

A

A

-

c

-

-

A

-

-

Gl»

Arg

Ser

Met

Ala

Bd

ABO BIO6

-

-

c,

-

Gly

-

-

-

T

Asp

Ser

Met

-

Ala

-

-

A

-

-

b,

-

-

-

-

-

Gly

-

-

-

-

-

Ser

Met

-

Ala

-

-

-

Trp

-

B-

b!

*

g

GIv

-

-

-

T

-

Ser

A Met

Ala

-

-

A

Trp

-

B,a,

-

-

-

-

G

-

-

-

-

-

A

A

-

G

-

-

-

-

A

Gly

Ser

Met

Ala

B,a.

-

g

-

G

-

-

-

-

-

-

A

-

c

-

-

A

-

-

Gly

Met

Ala

O alleles

Exon 6

Kxon "

Other nt:

261

29"

454

467

564

■ ■

657 669

681

703

721

771 796

802

S03

798-804 829

871

930 1054

1059-1061

1096

Phenotype

Allele

Name aa:

-

-

156

-

214

216

- 223

-

235

-

- 266

267

268

27"

291

- 352

-

Ai

ABO All»

A'

c;

A

T

C

C

C

T

T

c G

G

c;

g

c c

g

G

GGGGGGG G

G

G C

ccc

G

Pro

Ar»

Met

Phe

Glu

Gly

Leu

Glv

Gly

Val

Asp

Arg

o

ABO 0101

O'

AG

-

STOP

->

aal 16

o

ABO Ol02

o'

ag

STOP

c:

o

ABO Ol03

O1

ag

g

STOP

o

ABO 0104

O1

c

o

ABO 0201

O'

ag

g

STOP

_

_

_

A

_

A

_

_

T

_

A

_

_

_

variant

->

o

ABO OZOl

O'

ag

-

STOP

-

A

A

T

A

-

-

-

o

ABO 0203

O'

ag

g

STOP

-

-

-

-

A

- -

A

-

T

T

-

-

A

-

- -

-

o

o;

_

c;

C,

_

_

_

_

_

_

A

_

_

_

_

_

A

Gly

Arg

Gassner, C., Schmarda, A., Nussbaumer, W., et al (1996) ABO glycosyltransferase geno-typing by polymerase chain reaction using sequence-specific primers. Blood 88, 1852-1856.

Grunnet, N., Steffensen, R., Bennett, E.P., et al (1994) Evaluation of histo-blood group ABO genotyping in a Danish population: frequency of a novel O allele defined as O2. Vox Sang 67, 210-215.

Ogasawara, K., Bannai, M., Saitou, N., et al (1996) Extensive polymorphism of ABO blood group gene: Three major lineages of the alleles for the common ABO pheno-types. Hum Genet 97, 777-783.

Ogasawara, K., Yabe, R., Uchikawa, M., et al (1996) Molecular genetic analysis of variant phenotypes of the ABO blood group system. Blood 88, 2732-2757.

Ogasawara, K., Yabe, R., Uchikawa, M., et al (1998) Different alleles cause an imbalance in A, and A2B phenotypes of the ABO blood group. Vox Sang 74, 242-247.

Olsson, M.L. and Chester, M.A. (1995) A rapid and simple ABO genotype screening method using a novel B/O2 versus A/O1 discriminating nucleotide substitution at the ABO locus. Vox Sang 69, 242-247.

Olsson, M.L. and Chester, M.A. (1996) Evidence for a new type of O allele at the ABO locus, due to a combination of the A1 nucleotide deletion and the A'1 nucleotide insertion. Vox Sang 71, 113-117.

Olsson, M.L. and Chester, M.A. (1996) Frequent occurrence of a variant O1 gene at the blood group ABO locus. Vox Sang 70, 26-30.

Stroncek, D.F., Konz, R., Clay, M.E., et al (1994) Determination of ABO glycosyltransferase genotypes by use of polymerase chain reaction and restriction enzymes. Transfusion 35, 231-240.

Yamamoto, F. (1995) Molecular genetics of the ABO histo-blood group system. Vox Sang 69, 1-7.

Yamamoto, F., Clausen, H., White, T., et al (1990) Molecular genetic basis of the histo-blood group ABO system. Nature 345, 229-233.

MNS Blood Group System Facts Sheet

ISBT Gene Name: Organization:

Chromosome: Gene product:

MNS (GYPA/GYPB)

GYP A: 7 exons distributed over 60 kbp (cDNA 2,591 bp)

GYPB: 5 exons (plus 1 pseudoexon) distributed over 58 kbp (cDNA 612 bp)

4q28.2-q31.1

Glycophorin A (131 amino acids) Glycophorin B (72 amino acids)

GenBank Accession: GYPA: X51798; M60707 GYPB: J02982; M60708

MNS 1/MNS 2

MNS 3/MNS 4

STOP

MNS 1IMNS 2 (GYPA 60OT; 72G>A) encode M/N (S1L; G5E) MNS 3IMNS 4 (GYPB 236T>C) encode S/s (M29T)

Figure 4.2 MNS gene.

Alleles: Antigens:

MNS 1/MNS 2; MNS 3/MNS 4 M/N; S/s and numerous variants

Prevalence of gene products (%

based on phenotyping)

Phenotype

Caucasians

Blacks

M+N-S+s-

6

2

M+N-S+s+

14

7

M+N-S-s+

8

16

M+N+S+s-

4

2

M+N+S+s+

24

13

M+N+S-s+

22

33

M-N+S+s-

1

2

M-N+S+s+

6

5

M-N+S-s+

15

19

M+N-S-s-

0

0.4

M+N+S-s-

0

0.4

M-N+S-s-

0

0.7

Molecular protocols

PCR Condition: Cocktail in Protocol 3.10 Thermal Cycler: Profile 1 in Protocol 3.10

MNS 1

MNS 2

GPAM

Exon 2

GPAX2AS

Essentials of Human Physiology

Essentials of Human Physiology

This ebook provides an introductory explanation of the workings of the human body, with an effort to draw connections between the body systems and explain their interdependencies. A framework for the book is homeostasis and how the body maintains balance within each system. This is intended as a first introduction to physiology for a college-level course.

Get My Free Ebook


Post a comment