Chapter

1. Read, 5' to 3', the first 20 bases of the sequence in the gel on the right pictured in Figure 10-8. 5GGAGAGGGTCCTGGGAGGGT3'

2. After an automated dye primer sequencing run, the electropherogram displays consecutive peaks of the following colors:

red, red, black, green, green, blue, black, red, green, black, blue, blue, blue

If the computer software displays the fluors from ddATP as green, ddCTP as blue, ddGTP as black, and ddTTP as red, what is the sequence of the region given?

5TTGAACGTAGCCC3'

3. After an automated dye terminator sequencing run, the electropherogram displays bright (high, wide) peaks of fluorescence, obliterating some of the sequencing peaks. What is the most likely cause of this observation? How might it be corrected? These are dye blobs. They can be removed by careful cleanup of the sequencing ladder after the sequencing reaction.

4. In a manual sequencing reaction, the DNA ladder on the polyacrylamide gel is very bright and readable at the bottom of the gel, but the larger (slower migrating) fragments higher up are very faint. What is the most likely cause of this observation? How might it be corrected?

The ddNTP concentration is too high.

5. In an analysis of the p53 gene for mutations, the following sequences were produced. For each sequence, write the expected sequence of the opposite strand that would confirm the presence of the mutations detected. Normal:

5'TATCTGTTCACTTGTGCCCT3' (Homozygous substitution) 5'TATCTGTTCATTTGTGCCCT3' 5' AGGGCACAAATGAACAGATA3' (Heterozygous substitution) 5'TATCTGT(T/G)CACTTGTGCCCT3' 5' AGGGCACAAGTG(A/C)ACAGATA3' (Heterozygous deletion)

5'TATCTGTT(C/A)(A/C)(C/T)T(T/G)(G/T)(T/G) (G/C)CC(C/T)(T/...3'

5' AGGGCACAAGT(GA)A(A/C)(C/A)(A/G)(G/A) (A/T)(T/A)(A/...3'

6. A sequence, TTGCTGCGCTAAA, may be methylated at one or more of the cytosine residues: After bisulfite sequencing, the following results are obtained: Bisulfite treated: TTGCTGTGCTAAA Untreated: TTGCTGCGCTAAA

Write the sequences showing the methylated cytosines as CMe. TTGCMeTGCGCMeTAAA

7. In a pyrosequencing readout, the graph shows peaks of luminescence corresponding to the addition of the following nucleotides:

dT peak, dC peak (double height), dT peak, dA peak

What is the sequence?

Was this article helpful?

0 0

Post a comment