Bjrn Dahlbck Andreas Hillarp

Introduction, 173

Blood coagulation, 173

Regulation of blood coagulation, 174

Molecular genetics of venous thromboembolism, 175

Severe thrombophilia is a multigenic disease, 179

Management of thrombophilia, 181 Conclusions, 181

Antithrombin, protein C and protein S mutation databases on the Internet, 181

Further reading, 181

Introduction

The risk of venous thrombosis is increased when the hemostatic balance between pro- and anticoagulant forces is shifted in favor of coagulation. If this is caused by an inherited defect, the resulting hyp ercoagulable state conveys a lifelong increased risk of thrombosis. Inherited resistance to activated protein C (APC) is the most common hypercoagulable state found associated with venous thrombosis. It is caused by a single point mutation in the factor V (FV) gene, predicting the substitution of Arg506 with Gln. The FV gene mutation (FV Leiden or FV:Q506) confers a 5- to 10-fold increased risk of thrombosis and is found in 20-60% of Caucasian patients with thrombosis. Another common inherited risk factor for thrombosis is a point mutation (G20210A) in the 3' untranslated region of the prothrombin gene. This mutation is present in approximately 1-4% of healthy individuals and is associated with an approximately three-fold increased risk of thrombosis. Other less common genetic risk factors for thrombosis are the deficiencies of natural anticoagulant proteins, such as an-tithrombin, protein C and protein S. Such defects are present in fewer than 1% of healthy individuals and together account for 5-10% of genetic defects found in patients with venous thrombosis. Owing to the high prevalence of FV Leiden and of the G20210A mutation in the prothrombin gene, combinations of genetic defects are relatively common in the general population. As each genetic defect is an independent risk factor for thrombosis, individuals with multiple defects have a highly increased risk of thrombosis, and multiple defects are consequently often found in patients with thrombosis.

At sites of vascular damage, circulating platelets adhere to subendothelial structures and undergo a series of reactions, which lead to primary hemostasis due to the formation of a platelet plug. Concomitant to these events, the subendothelial membrane protein tissue factor (TF) is exposed to blood. A small amount of activated factor VII (FVIIa), present in circulating blood, binds to TF and triggers a series of proteolytic reactions which culminate in the formation of thrombin and the conversion of fibrinogen to insoluble fibrin.

FVIIa bound to TF specifically cleaves and activates the two vitamin K-dependent plasma proteins, factor IX (FIX) and factor X (FX) (Plate 15.1). Activated FX (FXa) activates prothrombin to thrombin, whereas activated FIX (FIXa) activates FX. Both FIXa and FXa are poor enzymes that require protein cofactors, calcium ions and negatively charged phospholipid surfaces for the expression of their full biological activity. The protein cofactors for FIXa and FXa are the activated forms of factor VIII (FVIIIa) and factor V (FVa), respectively. As a result of multiple protein-protein and protein-phospholipid interactions, enzymatically highly efficient complexes are assembled on the phospholipid surface.

The initiation of blood coagulation by TF is usually referred to as the extrinsic pathway or the TF pathway. In association with injury, this is the physiologically most important mechanism of blood coagulation. However, coagulation can also be activated through the intrinsic pathway, which is triggered by the activation of the contact phase proteins (FXII, FXI, prekallikrein and high molecular weight kininogen) that follows upon exposure of blood to certain negatively charged surfaces. The intrinsic pathway does not appear to be physiologically important for injury-related coagulation in vivo; this is illustrated by the lack of bleeding problems in individuals with deficiency of FXII.

Thrombin generated at sites of vascular injury expresses a number of procoagulant properties. It amplifies the coagulation process by activating FXI and in addition it activates

Blood coagulation platelets and converts fibrinogen to fibrin. Moreover, in a positive feedback reaction, thrombin converts the procofac-tors FV and FVIII into their biologically active counterparts (FVa and FVIIIa).

The efficient reactions of the coagulation system have considerable biological potential and strict regulation is required. For this purpose, several plasma proteins and protein-cell interactions are involved in the constant monitoring of the circulation. At each level of the coagulation pathway, membrane-bound molecules expressed on the surface of intact endothelial cells, circulating inhibitors and negative feedback mechanisms provide efficient control.

Antithrombin (AT) is the most important serine protease inhibitor (serpin) involved in the regulation of blood coagulation. AT inhibits thrombin as well as FXIa, FIXa and FXa and, under certain conditions, also FVIIa. AT forms a highly stable complex with the protease and, as a consequence, the protease is trapped and eliminated from the circulation. The activity of AT is stimulated by heparin, which accelerates the rate of formation of the AT-protease complexes. Under normal physiological conditions, heparan sulfate proteoglycans present on the endothelial cell surface stimulate the activity of AT, whereas heparin injections are used in clinical situations. During inhibition of thrombin, an important role of heparin is to function as a bridge between thrombin and AT. In addition, heparin induces conformational changes in AT, which are associated with the generation of a more efficient inhibitor. In the inhibition of FXa, the conformational change appears to be more important than the bridging mechanism.

The TF pathway is regulated by the TF pathway inhibitor (TFPI). TFPI is composed of three protease inhibitory domains belonging to the Kunitz type of inhibitors. TFPI has the unique capacity to inhibit the FVIIa-TF-FXa complex and is therefore highly efficient in turning off the TF pathway. The inhibition mediated by TFPI occurs in two steps. The first step is inhibition of FXa by the middle Kunitz domain; the first Kunitz domain then binds and inhibits FVIIa. Most of the TFPI is bound to glucosaminoglycans on endothelial cells (approximately 80%) and only a minor fraction of TFPI is present in plasma, where it is mainly associated with low-density lipoproteins.

The highly efficient procoagulant reactions of thrombin are physiologically adequate at sites of vascular injury and are instrumental in efficient hemostasis. However, the same reactions pose a threat to the organism as uncontrolled coagulation leads to thrombus formation. Nature has solved this dilemma in intricate and fascinating ways, one of which is the transformation of thrombin into an efficient initiator of a natural an ticoagulant pathway, the protein C system. The conversion of thrombin from a procoagulant into an anticoagulant enzyme depends on the presence of intact endothelium. Thus, thrombin generated at sites of intact vasculature binds to the endo-thelial membrane protein thrombomodulin, which is a potent modulator of thrombin activity and a cofactor to thrombin in the activation of protein C (Plate 15.2). A recently discovered receptor for protein C, the endothelial protein C receptor (EPCR), has been shown to stimulate the activation of protein C by the thrombin-thrombomodulin complex. APC degrades membrane-bound FVa and FVIIIa by limited proteolysis in reactions which are potentiated by a cofactor protein designated protein S and, in the case of FVIIIa degradation, also by the non-activated form of FV (Plate 15.3).

Under physiological conditions, pro- and anticoagulant mechanisms are balanced in favor of anticoagulation, whereas the anticoagulant system is downregulated and procoagulant forces prevail at sites of vascular damage. Defects in this ingenious system are associated with increased thrombin generation, a hypercoagulable state, leading to an increased risk of thrombosis.

The protein C anticoagulant system

Protein C is a vitamin K-dependent plasma protein, which is synthesized mainly in the liver. It is homologous to FVII, FIX and FX and shares with them a common modular organization. From the N-terminus, these proteins contain a vitamin K-dependent y-carboxyglutamic acid (Gla)-rich module, two epidermal growth factor (EGF)-like modules and a serine protease module. The Gla domains bind calcium ions and provide the vitamin K-dependent clotting proteins with phospholipid-binding properties. Upon activation by the thrombin-thrombomodulin complex, the serine protease module is converted to an active enzyme. APC is highly specific in its proteolytic activity, cleaving a limited number of peptide bonds in FVa and FVIIIa.

Intact FV is a high molecular weight protein and shares with the homologous FVIII molecule the modular arrangement A1, A2, B, A3, C1, C2. Upon activation of FV by thrombin or FXa, peptide bonds surrounding the B module are cleaved, and the B module is not part of FVa. FVIII is activated by thrombin in a similar fashion, which leads to release of the B module. APC cleaves three peptide bonds in FVa, at Arg306, Arg506 and Arg679, whereas FVIIIa is cleaved at Arg336 and Arg526. As a consequence of the APC-mediated cleavages, FVa and FVIIIa lose their procoagulant properties.

APC alone has poor anticoagulant activity and it is only in the presence of its cofactors, protein S and FV, that efficient anticoagulant function is expressed. This was demonstrated in an experimental system based on the degradation of FVIIIa. In this system, it was found that full anticoagulant activity of

Regulation of blood coagulation

APC was obtained in the presence of the combination of FV and protein S. The synergistic APC cofactor activity of FV requires APC-mediated proteolysis of at least the Arg506 cleavage site. This is important for the understanding of the mechanism of APC resistance, being the result of the Arg506^Gln mutation (FV Leiden; see below). The APC cofactor activity of FV appears specific for the degradation of FVIIIa, whereas the FVa degradation is unaffected by this FV activity. FV loses its APC cofactor activity upon proteolysis by thrombin, but it gains procoagulant properties as a cofactor to FXa. Thus, FV is similar to thrombin in being able to express both pro- and anticoagulant effects. However, whereas the anticoagulant effects of thrombin depend on its binding to thrombomodulin, the anticoagulant properties of FV are dependent on APC-mediated proteolysis of the non-activated form of FV. The detailed mechanisms by which FV functions as an APC cofac-tor remain to be elucidated.

Protein S is also a vitamin K-dependent plasma protein but, unlike the other vitamin K-dependent coagulation proteins, it is not a serine protease. It is a multimodular protein containing a Gla module, a thrombin-sensitive module, four EGF-like modules and a large module homologous to sex hormone-binding globulin (SHBG) (Figure 15.4). Protein S also has functions outside the protein C system and 60-70% of protein S in plasma circulates bound to C4b-binding protein (C4BP), a regulator of the complement system. The Gla-module of protein S provides both free protein S and the protein S-C4BP complex, with phospholipid-binding ability. This is important for the localization of coagulation and complement regulatory activities to certain cell membranes—for example, to the phosphatidyl serine that is exposed on apop-totic cells. Protein S binding to such cells has been shown to be involved in stimulation of phagocytosis of these cells.

During the degradation of free FVa (i.e. not bound to FXa) by APC, the cleavage at Arg506 is faster than that at Arg306. The cleavage at Arg506 leads only to partial loss of FVa activity, whereas the cleavage at Arg306 leads to efficient inactivation of FVa. Protein S serves as cofactor for the cleavage at Arg306 but has minor effects on the Arg506 cleavage. This, together with a specific protection of the Arg506 site exerted by FXa, indicates that the Arg306 site is the most important site for the regulation of FVa activity in the prothrombinase complex. On the other hand, FVa, which is not part of a prothrombinase complex, is first cleaved at the Arg506 site, because the kinetics of this cleavage are more favorable than those for the cleavage site at Arg306. In in vitro experiments, protein S has been shown to express an anticoagulant activity that is independent of the presence of APC. The exact mechanism is unknown but has been suggested to be related to inhibition of prothrombin activation through direct interactions of protein S with FVa, FXa and the phospholipid membrane. The in vivo physiological significance of this APC-independent anticoagulant activ ity is unclear. Regardless of its mode of action, protein S is an important anticoagulant protein in vivo, as demonstrated by animal studies and by the association between protein S deficiency and venous thrombosis.

Molecular genetics of venous thromboembolism

The annual incidence of venous thrombosis in Western societies is approximately 1-2 per 1000. Thrombotic episodes tend to occur in conjunction with surgery, fractures, pregnancy, the use of oral contraceptives and immobilization. In addition, genetic defects are frequently involved and many patients report positive family histories. Genetic defects known to predispose to thrombosis include inherited APC resistance due to FV Leiden, a point mutation in the prothrombin gene (G20210A) and deficiencies of anticoagulant protein C, protein S or AT.

Factor V gene mutation (FV Leiden) causing APC resistance

In 1993, APC resistance was described as a cause of inherited thrombophilia and it was soon demonstrated to be highly prevalent (20-60%) among thrombosis patients. In APC resistance, APC does not give a normal prolongation of the clotting time. In more than 95% of cases the molecular defect associated with APC resistance is a single point mutation in the FV gene. The mutation is a G^A substitution at nucleotide position 1691 in the FV gene, which predicts replacement of Arg506 with a Gln. The mutant FV is known as FVR506Q, FV Leiden or F: Q506 (R and Q are one-letter codes for Arg and Gln, respectively).

The FV Leiden allele is found only in Caucasians, and the prevalence of the mutant FV Leiden allele in the general population of Western societies demonstrates considerable variation. High prevalence (up to 15%) is found in southern Sweden, Germany, Greece, Arab countries and Israel. In the Netherlands, the UK and the USA around 3-5% of the population carry the mutant allele. Lower prevalence (around 2%) is found in Hispanics. The high prevalence of the FV Leiden allele in certain populations suggests a possible survival advantage, and there is a reduced risk of bleeding after delivery in women carrying the mutation. In the history of mankind, the slightly increased risk of thrombosis associated with the FV Leiden allele has presumably not been a negative survival factor because thrombosis develops relatively late in life and does not influence fertility. In addition, many of the circumstantial risk factors for thrombosis, such as a sedentary life style, surgery and the use of oral contraceptives, did not affect our ancestors.

The high prevalence of the FV Leiden allele in Western societies is the result of a founder effect. It has been estimated that the mutation event was around 30 000 years ago, i.e. after the 'Out of Africa March', which took place 100 000 years ago and also after the separation of the Asians from the Europeans. This explains why the mutant FV allele is common among European populations but is not present among Japanese, Chinese, and the original populations of Africa, Australia and America.

A large number of studies have demonstrated relationships between the presence of APC resistance (FV Leiden) and an increased risk of venous thrombosis. Differences in the selection criteria of patients and in the prevalence of the mutant allele in the general population explain the wide variation in results obtained from different studies. However, the general consensus is that the FV Leiden allele is the most common genetic risk factor for venous thrombosis in Western societies. The odds ratio, describing the increased risk of thrombosis in affected individuals, has been calculated to be six- to eight-fold for those carrying the defect in a heterozygous form, whereas homozygous individuals are at 30- to 140-fold increased risk of thrombosis. The FV Leiden allele does not appear to be a strong risk factor for arterial thrombosis, such as myocardial infarction. Two mutations affecting the Arg306 site have recently been found in thrombosis cases, FV Cambridge and FV Hong Kong, but such mutations appear to be rare. They do not result in APC resistance and are not major risk factors for thrombosis.

The FV Leiden allele is associated with a hypercoagulable state, which is reflected in increased levels of prothrombin activation fragments in the plasma of individuals with inherited APC resistance. Two molecular mechanisms are involved (Figure 15.1). In one of these mechanisms, an APC cleavage site in FVa is lost, which impairs the normal degradation of FVa by APC. The other surprising observation is that FV Leiden is a poor APC cofactor in the degradation of FVIIIa because the cleavage at Arg506 is required for expression of APC cofactor activity of FV.

In the degradation of normal FVa, the APC cleavage at Arg506 has favorable kinetics compared with cleavages at other sites. The Arg506 cleavage is approximately 10-fold faster than the cleavage at Arg306 and the activity of FVa: Q506 (FVa Leiden) is therefore inhibited at an approximately 10-fold lower rate than FVa : R506. Generated FVa Leiden persists longer than normal FVa and can form active prothrombinase complexes with FXa. However, degradation of free FVa (i.e. FVa not bound to FXa) is different from that of FVa, which is part of the pro-thrombinase complex. In the prothrombinase complex, the Arg506 site is protected by FXa from degradation by APC. In addition, protein S functions as an APC cofactor primarily for the Arg306 cleavage. As a consequence, APC-mediated degradation of FVa, which is part of the prothrombinase complex,

Thrombin FXa

Procoagulant FVa

Inactive FVi

Thrombin FXa

Procoagulant FVa

Inactive FVi

Fig. 15.1 Pro- and anticoagulant properties of factor V

Proteolytic modification of single-chain factor V (FV) results in the expression of either pro- or anticoagulant properties. Thrombin and FXa cleaves and activates FV to a procoagulant (FVa) that functions as a cofactor to FXa in the activation of prothrombin. Intact FV is sensitive to cleavage by APC, which recruits FV into an anticoagulant path. FV modified by APC (FVac) functions as a synergistic APC cofactor with protein S in the degradation of FVIIIa. The anticoagulant properties of FV are lost upon further proteolysis by thrombin or FXa. Likewise, the procoagulant effects of FVa are lost as a result of cleavage by APC. Thus, FV plays a crucial and central part in balancing pro- and anticoagulant forces. Arrowheads denote the three APC cleavage sites.

follows a different pathway compared with that of free FVa. Therefore, when FVa : R506 and FVa: Q506 are part of assembled prothrombinase complexes, the rates of their degradation by APC plus protein S are similar.

Laboratory investigation of inherited APC resistance due to the FV Leiden allele can be done both with a functional APC-resistance test and with molecular biology assays. A modified APC-resistance test involving dilution of the patient's plasma in FV-deficient plasma is highly sensitive and specific for the presence of the FV Leiden allele. The most commonly used molecular assay for FV Leiden involves polymerase chain reaction (PCR) amplification and restriction enzyme digestion.

Deficiency of antithrombin

Heterozygous AT deficiency is found in between 0.02 and 0.05% of the general population and in 1-2% of thrombosis patients, suggesting that the genetic defect is associated with a 10- to 20-fold increased risk of thrombosis—somewhat higher

Molecular coagulation and thrombophilia 177

than estimated for APC resistance. AT deficiency may be of either type I or type II. Type I deficiency is characterized by low levels of both immunological and functional AT, whereas type II denotes functional defects. Type II cases are divided into three subtypes: RS (reactive site mutants), HBS (heparin binding site mutants) and PE (mutants giving pleiotropic effects). A large number of AT deficiencies have been genetically analyzed (Figure 15.2). In most cases, the genetic defect is a point mutation, a small deletion or an insertion. Partial or whole-gene deletions are relatively uncommon causes of AT deficiency. Type II RS variants are defective in protease inac-tivation, and mutations in the vicinity of the reactive site have been found. The type II HBS deficiency carries mutations in the heparin binding site and type II PE AT variants are caused by a limited number of mutations between amino acids 402 and 429.

Protein C deficiency

Heterozygous deficiency of protein C is identified in 2-5% of thrombosis patients. The prevalence of protein C deficiency in the population is estimated to be approximately 0.3%. The 10-fold higher prevalence of protein C deficiency in thrombosis cohorts suggests that carriership is associated with a 10-fold increased risk of venous thrombosis, that is, a risk essentially similar to that associated with APC resistance. Protein C deficiency is not a risk factor for arterial thrombosis. Two types of protein C deficiency have been described. In type I, there is a parallel reduction in protein C antigen and func tional activity. Type II is characterized by a functional defect in the protein, and its plasma concentration may be normal. The majority of reported cases of protein C deficiency are of type I. Homozygous or compound heterozygous protein C deficiency is a rare condition (1/200 000-1/400 000) that leads to severe and fatal thrombosis in the neonatal period. The clinical picture is that of purpura fulminans and the symptoms include necrotic skin lesions due to microvascular thrombosis. Other major symptoms are thrombosis in the brain and disseminated intravascular coagulation. Several cases have been successfully treated with fresh frozen plasma or with protein C concentrates.

Genetic analysis has been performed in a large number of cases with protein C deficiency (160 different mutations are known). Most genetic defects are missense mutations located within the region coding for the mature protein, which lead to single amino acid substitutions and type I deficiency (Figure 15.3). Mutations in the promoter region of the gene, which affect the plasma protein concentration, and mutations affecting the RNA splicing have also been found. In a minority of cases, the genetic defects lead to a type II deficiency. Mutations leading to type II deficiency have been found in almost all the modules of protein C, including the propeptide, the Gla module, EGF1, the activation peptide, and the serine protease domain.

Protein S deficiency

Heterozygous protein S deficiency is present in 1-5% of thrombosis patients. The prevalence of protein S deficiency

1 kb

Fig. 15.2 Structure of the human antithrombin gene and locations of detrimental missense mutations in the antithrombin molecule

The gene for antithrombin (AT) is localized to chromosome 1 (1q23-q25) and spans 13.4 kb of DNA (upper part). It comprises seven exons and results in an mRNA of 1.7 kb (middle part). The AT molecule (lower part) is synthesized as a single polypeptide chain composed of a mature protein containing 432 amino acid residues, and a signal peptide (shaded) of 32 amino acid residues. Many mutations of different types causing AT deficiency have been described. Shown here are only missense mutations leading to amino acid substitutions associated with type I deficiency (indicated by open circles below the polypeptide chain) or type II deficiency. Open, shaded and filled circles denote type II HBS, type II RS and type II PE variants, respectively.

Exon 1

3A 3B 4

1 kb

3A 3B 4

mRNA

Type II

Type I

Polypeptide

100 aa

Exon

1 kb

Type II

Type I

mRNA

mRNA

100 aa

Fig. 15.3 Structure of the human gene and locations of detrimental missense mutations in the protein C molecule

Human protein C is encoded by the PROC gene, localized to chromosome 2 (2q13-q14), which spans approximately 11 kb of DNA (upper part). The gene comprises nine exons, which yield a ~1.8 kb mRNA transcript (middle part). The protein C mRNA encodes a prepro-protein C sequence of 461 amino acid residues (lower part). The pre-sequence (shaded) serves as a signal peptide and the pro-sequence (light shading) functions as the signal for proper y-carboxylation of the protein. The mature protein consists of 419 residues and can be divided into a y-carboxy (glutamic acid (Gla) domain, two epidermal growth factor (EGF) domains and a serine protease domain. During processing of the protein, an internal dipeptide is removed from the protein and the mature protein circulates as a covalently linked two-chain molecule. Between the second EGF domain and the protease part of the molecule is an activation peptide (AP) region, which is released upon protein C activation. The circles indicate the locations of known missense mutations, leading to amino acid substitutions associated with type I deficiency (indicated below the polypeptide chain) or type II deficiency (above the polypeptide chain).

100 aa

Fig. 15.3 Structure of the human gene and locations of detrimental missense mutations in the protein C molecule

Human protein C is encoded by the PROC gene, localized to chromosome 2 (2q13-q14), which spans approximately 11 kb of DNA (upper part). The gene comprises nine exons, which yield a ~1.8 kb mRNA transcript (middle part). The protein C mRNA encodes a prepro-protein C sequence of 461 amino acid residues (lower part). The pre-sequence (shaded) serves as a signal peptide and the pro-sequence (light shading) functions as the signal for proper y-carboxylation of the protein. The mature protein consists of 419 residues and can be divided into a y-carboxy (glutamic acid (Gla) domain, two epidermal growth factor (EGF) domains and a serine protease domain. During processing of the protein, an internal dipeptide is removed from the protein and the mature protein circulates as a covalently linked two-chain molecule. Between the second EGF domain and the protease part of the molecule is an activation peptide (AP) region, which is released upon protein C activation. The circles indicate the locations of known missense mutations, leading to amino acid substitutions associated with type I deficiency (indicated below the polypeptide chain) or type II deficiency (above the polypeptide chain).

in the general population has been estimated to be between 0.03 and 0.13%. Family studies suggest that heterozygous carriers have a 5- to 10-fold increased risk of thrombosis compared with their healthy relatives, which is similar to that associated with protein C deficiency and APC resistance. The level of free protein S discriminates better between people with and without protein S deficiency than the level of total protein S. This is because the concentrations of protein S and C4BPß+, which is the protein S-binding isoform of C4BP, are equimolar in protein S-deficient individuals and most of the protein S is bound to C4BPß+. Protein S deficiency with low levels of both free and total protein S is called type I, whereas protein S deficiency with low free protein S and normal total protein S has been believed to constitute a separate genetic type (type III). However, coexistence of the two types in many protein S-deficient families demonstrates that they represent different phenotypic variants of the same genetic disease. Mutations in protein S leading to functional defective molecules are referred to as type II deficiency. To date, very few type II deficiencies have been found, which presumably is related to the poor diagnostic performance of available functional protein S assays. Homozygous protein S deficiency is extremely rare, but appears to give a picture similar to that of homozygous protein C deficiency, with purpura fulminans in the neonatal period. To date, more than 140 mutations in the protein S gene have been reported. Most of the gene defects are missense or nonsense mutations, and mutations affecting splicing or insertion/deletion defects are less common (Figure 15.4). Because of the large size of the protein S gene and the presence of a closely linked and highly similar pseudogene, the identification of mutations is not easy. With current molecular biology techniques, a genetic approach would be too costly for routine use. Furthermore, in some families with phenotypically established protein S deficiency, protein S gene mutations are not found. The reason for the difficulty in identifying protein S gene mutations in some families is unclear.

1 kb

Type II

Type I

mRNA

200 bp

200 bp

EGF1

EGF2

EGF3

EGF4

SHBG

100 aa

Fig. 15.4 Structure of the human protein S gene and location of detrimental missense mutations in the protein S molecule

The gene for human protein S (PROS1) comprises 15 exons (upper part of the figure), spans over 80 kb of DNA and is localized to chromosome 3 (3p11.1-q11.2). Exons are denoted by open bars and introns by lines. Introns denoted by dashed lines between exons indicate gaps .and are not drawn to scale. The PROS1 mRNA is approximately 3.5 kb in size (middle part of the figure). The mRNA is translated into a 676 amino acid residue prepro-protein S (lower part of the figure). The polypeptide chain can be divided into a signal peptide (dark grey), a pro-peptide (light grey), a thrombin-sensitive region (TSR), a y-carboxyglutamic acid (Gla) domain, four epidermal growth factor (EGF)-like domains and a large carboxy-terminal domain homologous to sex hormone-binding globulin (SHBG). The circles indicate the localizations of known missense mutations that lead to amino acid substitutions associated with type I deficiency (indicated below the polypeptide chain) or type II deficiency (above the polypeptide chain).

Prothrombin mutation

A point mutation in the prothrombin gene (nucleotide 20210 G^A) has been identified as the second most common independent risk factor for venous thrombosis. The mutation is located in the 3' untranslated region and the mechanism by which this mutation leads to an increased risk of thrombosis is not fully understood, even though it has been shown that the mutation is associated with increased plasma levels of prothrombin (Figure 15.5). The prevalence of the mutation in the general population is heterogeneous and dependent on geographical location and ethnic background. By analogy with the FV Leiden mutation, the prothrombin gene mutation is mainly found in populations of Caucasian origin. In southern Europe the prevalence is 2-4%, nearly as twice as high as that in northern Europe. Founder effects are the likely explanation for the differences in the distribution of the prothrombin 20210 G^A mutation. The mutation is found in 6-16% of patients with unselected deep venous thrombosis and carriers have an approximately three- to four-fold increased risk of thrombosis.

Severe thrombophilia is a multigenic disease

Venous thrombosis is a typical multifactorial disease, involving one or more environmental and/or genetic risk factors. In Western societies many individuals carry more than one genetic risk factor because the FV Leiden allele is so common. In contrast, in countries where the FV Leiden allele is rare few individuals carry more than one genetic defect. This may explain the difference in the incidence of thromboembolic disease between Japan and China on the one hand and Europe and the USA on the other. The frequency of individuals carrying two or more genetic defects can be calculated on the basis of the prevalence in the general population of the individual genetic defects. In a country where the prevalence of FV Leiden is 10%, combinations of protein C deficiency and FV Leiden are expected to be present in between 1 in 3000 and 1 in 10 000 individuals. A similar calculation for the combination of the prothrombin mutation and FV Leiden allele suggest the prevalence of combined defects to be 1-2 per 1000 individuals. Thus, a large number of people carry more

1 kb

Exon

13 14

. ATGGTTCCCAATAAAAGTGACTCTCAGC GAGCCTC .

Fig. 15.5 Structure of the human prothrombin gene and localization of the prothrombin 20210 G^A mutation

The human gene for prothrombin (F2) comprises 14 exons and spans approximately 20 kb of DNA on chromosome 11 (Ilp1l—q12). The nucleotide sequence flanking the G^A transition at nucleotide 20210 (indicated in bold) in the 3' untranslated region of the F2 gene is shown below. The putative polyadenylation signal is boxed. The 20210A allele has been reported to be associated with elevated levels of plasma prothrombin and an increased risk of venous thrombosis.

13 14

than one genetic defect and such individuals have considerably increased risk of thrombosis. The FV Leiden allele is thus found to be an additional genetic risk factor in certain throm-bophilic individuals with deficiency of protein C, protein S or AT, as well as in cases with the prothrombin mutation (Figure 15.6). In a pooled analysis of the two most common defects, heterozygosity for the FV Leiden and prothrombin 20210 G^A mutations, the combined risk of venous thrombosis was 20-fold compared with a risk of 4.9 and 3.8 for the two single defects respectively.

The thrombotic tendency in individuals with inherited genetic defects is highly variable and some individuals never get thrombosis, whereas others develop recurrent severe thrombotic events at an early age. This depends on the particular genotype, the coexistence of other genetic defects and the presence of environmental risk factors, such as oral

Age (years)

Fig. 15.6 Thrombosis-free survival curves for individuals with different FV genotypes and co-inherited protein S deficiency

(a) The increased risk of thrombosis with combined defects is illustrated by thrombosis-free survival curves for 21 individuals with single defects, FV Leiden or protein S deficiency, and 18 individuals with both defects. There was no significant difference between the two groups with single defects, whereas differences between the groups with either the FV Leiden allele or protein S deficiency and the group with combined defects were significant.

(b) Probability of being free of thrombotic events at a certain age for 146 normal individuals, 144 heterozygotes and 18 homozygotes for the FV Leiden allele (Kaplan-Meier analysis). Highly significant differences were observed between normals and heterozygotes and between heterozygotes and homozygotes.

contraceptives, trauma, surgery and pregnancy. Thus, women with heterozygosity for the FV Leiden allele who also use oral contraceptives have been estimated to have a 35- to 50-fold increased risk of thrombosis, whereas those with homozygosity have a several hundred-fold increased risk.

Decisions about medical intervention due to the presence of one or more genetic defects should be based on careful consideration of the clinical picture, including the patient's family history. The risk of bleeding complications due to anticoagulant therapy must always be weighed against the benefits of the anticoagulation effect, especially if an oral anticoagulant is used for periods exceeding 3-6 months, after which the risk of thrombotic recurrence probably declines. New clinical data are continually emerging and no general consensus regarding the screening, prophylaxis and treatment of symptomatic patients has yet been established.

When the FV Leiden allele is present in homozygous form, or when heterozygosity is combined with a second genetic defect, prophylactic treatment with heparin or oral anticoagulants is recommended in situations known to be associated with a high risk of thromboembolic complications, such as surgery or pregnancy, even if the patient has never experienced any thrombosis or has no family history of such complications. For heterozygous, asymptomatic carriers lacking a family history of thrombosis, short-term prophylaxis has been recommended in high-risk situations, but it remains to be established whether prophylaxis should be given in all situations associated with a risk of thrombosis.

Treatment of symptomatic heterozygous patients should be initiated as for any other patient with thrombotic events. It is not known whether the presence of a genetic defect is associated with an increased risk of recurrence, even though most studies on APC resistance tend to suggest that this is indeed the case. Patients with combined defects and probably also patients with single gene defects may be at increased risk of recurrence and should accordingly be given extended anticoagulation therapy beyond 6 months, even after an isolated thromboembolic event. However, more data are needed before these recommendations can be considered generally applicable.

The potential benefits of general screening for APC resistance and/or the FV Leiden allele prior to thrombotic events or in the presence of such circumstantial factors as oral contraceptive usage, pregnancy and surgery are obvious, but more prospective data are needed, not least in terms of cost-benefit ratios, before any general recommendations can be made.

Conclusions

Inherited APC resistance, caused by the FV Leiden mutation, is the most common genetic risk factor for thrombosis identified to date. The mutated FV has normal procoagulant properties, but the loss of the APC cleavage site at position 506 in FV results in impaired regulation of coagulation and a hypercoagulable state. The prevalence of FV Leiden in Caucasian populations varies between 2 and 15%. A genetic variant in the prothrombin gene (G20210A) is another common prothrombotic risk factor, with a prevalence of approximately 1-4% in the general population. Other, less common independent genetic risk factors include abnormalities in the genes for antithrombin, protein C and protein S. Families with thrombophilia present with variable penetrance of thrombosis that may be explained by different combinations of genetic defects and environmental risk factors. Patients with combined genetic defects are at higher risk of thrombosis than those with single gene defects. Thus, a detailed laboratory investigation is an important component of the evaluation process and needs to be performed in order to estimate the risk of thrombosis in each case.

Antithrombin, protein C and protein S mutation databases on the Internet

Antithrombin mutation database: http://www.med.ic.ac.uk/

divisions/7/antithrombin/default.htm Protein C mutation database: http://www.xs4all.nl/~reitsma/

Prot_C_home.htm Protein S mutation database: http://archive.uwcm.ac.uk/ uwcm/mg/search/120721.html

Further reading

Blood coagulation: introduction and regulation

Dahlbäck B. (2000) Blood coagulation. Lancet, 355, 1627-1332.

Dahlbäck B, Stenflo J. (2000) The protein C anticoagulant system. In: Stamatoyannopoulos G, Nienhuis AW, Majerus PW et al. (eds) The Molecular Basis of Blood Diseases, 3rd edn. Philadelphia: W.B. Saunders, pp. 614-656.

Esmon CT. (1992) The protein C anticoagulant pathway. Arteriosclerosis and Thrombosis, 12, 135-145.

Management of thrombophilia

Venous thromboembolism: mechanisms and risk factors

Dahlbäck B, Carlsson M, Svensson PJ. (1993) Familial thrombophilia due to a previously unrecognized mechanism characterized by poor anticoagulant response to activated protein C: prediction of a cofac-tor to activated protein C. Proceedings of National Academy of Sciences of the United States of America, 90, 1004-1008.

Franco RF, Reitsma PH. (2001) Genetic risk factors of venous thrombosis. Human Genetics, 109, 369-384.

Lane D, Mannucci PM, Bauer KA et al. (1996) Inherited thrombophilia: Part 1. Thrombosis and Haemostasis, 76, 651-662.

Lane D, Mannucci PM, Bauer KA et al. (1996) Inherited thrombophilia: Part 2. Thrombosis and Haemostasis, 76, 824-834.

Reitsma PH. (2000) Genetic heterogeneity in hereditary thrombophilia. Haemostasis, 30 Supplement 2, 1-10.

Rosendaal FR. (1997) Risk factors for venous thrombosis: prevalence, risk, and interaction. Seminars in Hematology, 34, 171-187.

Zöller B, Garcia de Frutos P, Hillarp A et al. (1999) Thrombophilia as a multigenic disease. Haematologica, 84, 59-70.

APC resistance and factor V Leiden

Bertina RM, Koeleman BP, Koster T et al. (1994) Mutation in blood coagulation factor V associated with resistance to activated protein C. Nature, 369, 64-67.

Dahlbäck B. (1997) Resistance to activated protein C as risk factor for thrombosis: molecular mechanisms, laboratory investigation, and clinical management. Seminars of Hematology, 34, 217-234.

Dahlbäck B. (1999) Procoagulant and anticoagulant properties of coagulation factor V: factor V Leiden (APC resistance) causes hypercoagulability by dual mechanisms. Journal of Laboratory and Clinical Medicine, 133, 415-422.

Koster T, Rosendaal FR, de Ronde H et al. (1993) Venous thrombosis due to poor anticoagulant response to activated protein C: Leiden Thrombophilia Study. Lancet, 342, 1503-1506.

Lindqvist PG, Svensson PJ, Dahlbäck B et al. (1998) Factor V R506Q mutation (activated protein C resistance) associated with reduced intrapartum blood loss—a possible evolutionary selection mechanism. Thrombosis and Haemostasis, 79, 69-73.

Nicolaes GAF, Dahlbäck B. (2002) Factor V and thrombotic disease. Description of a Janus-faced protein. Arteriosclerosis, Thrombosis, and Vascular Biology, 22, 530-538.

Svensson PJ, Dahlbäck B. (1994) Resistance to activated protein C as a basis for venous thrombosis. New England Journal of Medicine, 330, 517-522.

Zivelin A, Griffin JH, Xu X et al. (1997) A single genetic origin for a common Caucasian risk factor for venous thrombosis. Blood, 89, 397-402.

Antithrombin

Kottke-Marchant K, Duncan A. (2002) Antithrombin deficiency. Issues in laboratory diagnosis. Archives of Pathology and Laboratory Medicine, 126, 1326-1336.

van Boven HH, Lane DA. (1997) Antithrombin and its inherited deficiency states. Seminars in Hematology, 34, 188-204.

Protein C

Reitsma PH. (1997) Protein C deficiency: from gene defects to disease. Thrombosis and Haemostasis, 78, 344-350.

Reitsma PH, Bernardi F, Doig RG etal. (1995) Protein C deficiency: a database of mutations, 1995 update. On behalf of the Subcommittee on Plasma Coagulation Inhibitors of the Scientific and Standardization Committee of the ISTH. Thrombosis and Haemostasis, 73, 876-889.

Protein S

Aiach M, Borgel D, Gaussem P et al. Protein C and protein S deficiencies. Seminars in Hematology, 34, 205-216.

Anderson HA, Maylock CA, Williams JA, Paweletz CP, Shu H, Shacter E. (2002) Serum derived protein S bind to the phosphatidylserine and stimulates the phagocytosis of apoptotic cells. Nature Immunology. Published online: doi:10.1038/ni871.

Gandrille S, Borgel D, Sala N et al. (2000) Protein S deficiency: a database of mutations—summary of the first update. For the Plasma Coagulation Inhibitors Subcommittee of the Scientific and Standardization Committee of the ISTH. Thrombosis and Haemostasis, 84, 918.

Rezende SM, Lane DA, Zöller B et al. (2002) Genetic and phenotypic variability between families with hereditary protein S deficiency. Thrombosis and Haemostasis, 87, 258-265.

Simmonds RE, Zöller B, Ireland H et al. (1997) Genetic and phenotypic analysis of a large (122-member) protein S-deficient kindred provides an explanation for the familial coexistence of type I and type III plasma phenotypes. Blood, 89, 4364-4370.

Webb JH, Blom A, Dahlbäck B. (2002) Vitamin K-dependent protein S localizing complement regulator C4b-binding protein to the surface of apoptotic cells. Journal of Immunology, 169, 2580-2586.

Prothrombin 20210 G^A mutation

Emmerich J, Rosendaal FR, Cattaneo M et al. (2001) Combined effect of factor V Leiden and prothrombin 20210 A on the risk of venous thromboembolism. Pooled analysis of 8 case-control studies including 2310 cases and 3204 controls. Thrombosis and Haemostasis, 86, 809-816.

Poort SR, Rosendaal FR, Reitsma PH et al. (1996) A common genetic variation in the 3'-untranslated region of the prothrombin gene is associated with elevated plasma prothrombin levels and an increase in venous thrombosis. Blood, 88, 3698-3703.

Rosendaal FR, Doggen CJM, Zivelin A et al. (1998) Geographic distribution of the 20210 G to A prothrombin variant. Thrombosis and Haemostasis, 79, 706-708.

10 Ways To Fight Off Cancer

10 Ways To Fight Off Cancer

Learning About 10 Ways Fight Off Cancer Can Have Amazing Benefits For Your Life The Best Tips On How To Keep This Killer At Bay Discovering that you or a loved one has cancer can be utterly terrifying. All the same, once you comprehend the causes of cancer and learn how to reverse those causes, you or your loved one may have more than a fighting chance of beating out cancer.

Get My Free Ebook


Post a comment