Rew

FIGURE 16-36 Recognition sites and sites of action of the A N and Q transcription antiterminators. The upper line shows the early ngbtward promoter PK and its initial terminator, fF,. The nut site is divided into two regions, called BoxA (7 bp) and BoxB, separated by a spacer region of 8 bp The sequence of BoxB has dyad symmetry and forms a stem-loop structure once transcribed into rna. The sequence of the RNA-like strand of nutR is shown above. The lower line shows the prorroter Pf,. the sequences essential for Q protein function, and the terminator at which 0 proiein acts terminators. N protein requires sites named nut (for N utilization) that are 60 unci '¿GO nucleotides downstream of PL and PR (see Figure 16-36). But N does not hind to these sequences within DNA. Rather, it binds to RNA transcribed from DNA containing a nut sequence.

Thus, once RNA polymerase has passed a nut site, N binds to the RNA and from there is loaded on to the polymerase itself. In this state, the polymerase is resistant to the terminators found just beyond the N and cro genes. X N works along with the products of the bacterial genes nusA, nusB, nusE, and nusC. The NnsA protein is an important cellular transcription factor. NusF is the small ribosomal subunit protein S10, but its role in N protein function is unknown, No cellular function of NusB protein is known. These proteins feral a complex with N at the nut site, but N can work in their absence if present at high concentration, suggesting that it is N itself that promotes antitermination.

Unlike N protein, the A Q protein recognizes DNA sequences (QBE) between the -10 and —35 regions of the late gene promoter (PR.) (see Figure 16-36). in the absence of Q, polymerase binds Pp- and initiates transcription, oj Jy to pause after a mere 16 or 17 nucleotides; it then continues but terminates when it reaches the terminator (fR) some 200 bp downstream, ff Q is present, it binds to QBE once the polymerase has left the promoter, and transfers from there to the nearby paused polymerase. With Q on board, the polymerase is then able to transcribe through iK.

Retro regulation: An Interplay of Controls on RNA Synthesis and Stability Determines int Gene Expression

The CII protein activates the promoter P, that directs expression of the int gene, as well as the promoter PR£ responsible for repressor synthesis (see Figure 16-25). The Int protein is the enzyme that integrates the phage genome into that of the host cell during formation of a 1 y so gen (see Chapter 11). Therefore, upon infection, conditions favoring CII protein activity give rise to a burst of both repressor and integrase enzyme.

But the int gene is transcribed from P, as well as from Pt! so one would have thought that integrase should be made even in the absence of ell protein. This does not happen. The reason is that inf messenger RNA initiated at PL is degraded by cellular nucleases, whereas mRNA initiated at P, is stable and can be translated into integrase protein. This occurs bccausc the two messages have different structures at their 3' ends.

RNA initiated at P, stops at a terminator about 300 nucleotides after the end of the int gene; it has a typical stem-and-loop structure followed by six uridine nucleotides (Figure 16-37; see Chapter 12, Figure 12-9). When RNA synthesis is initiated at PL, on the other hand, RNA polymerase is modified by the N protein and thus goes through and beyond the terminator. This longer mRNA can form a stem that is a substrate for nucleases. Because the site responsible tor this negative regulation is downstream of the gene it affects, and because degradation proceeds backward through the gene, this process is called retroregulation.

The biological function of ictroregulation is clear. When CII activity is low and lytic development is favored, there is no need for integrase enzyme; thus, its mRNA is destroyed. Hut when CII activity is high and lysogeny is favored, the inf gene is expressed to promote recombination of the repressed phage DNA into the bacterial chromosome.

site of termination in absence of N protein fff )tgatgacaaaaaattagcgcaagaagacaaaaatcaccttgc<^taatqctctqt ¡nt

, ACT AC TGTTTTTTAATCGC GTTCTTCTGTTTTTAGTGGAACGCQATT AC G AG AC A gene direction of transcription

Was this article helpful?

0 0

Post a comment