Info

orientations. Because messenger RNA is translated in a 5' to 3J direction, however, only the former is the correct coding sequence; if the latter were translated in a to 3' direction, then the resulting peptide would be NH2-Arg-Thr-COOH, rather than NH2-Thr-Arg-CO(JH.

The second rule is that codons are nonoverlapping and the message contains no gaps. This means that successive codons are represented by adjacent trinucleotides in register. Thus, the coding sequence for the tripeptide NH^-Thr-Arg-Ser-COOH is represented by three contiguous and nonoverlapping triplets in the sequence 5'-ACGCGAUCU-3\

The final rule is that the message is translated in a fixed rending frame, which is set by the initiation codon. As you will recall from Chapter 14, translation starts at an initiation codon, which is located at the 5' end of the protein-coding sequence. Because codons are nonoverlapping and consist of three consecutive nucleotides, a stretch of nucleotides could be translated in principle in any of three reading frames. It is the initiation codon that diclales which of the three possible reading frames is used. Thus, for example, the sequence 5'... ACGACGACGACGACGACGACG . .. 3' could be translated as a series of threonine codons (5'-ACG'-3'), a series of arginine codons (5'-CGA-3'J, or a series of asparate codons (5'-GAC-3') depending on the frame of the upstream start codon.

Three Kinds of Point Mutations Alter the Genetic Code

Now that we have considered the nature of the genetic code, it is instructive to revisit the issue of how the coding sequence of a gene is altered by point mutations (see Chapter 9). An alteration that changes a codon specific for one amino acid to a codon specific for another amino acid is called a missense mutation. As a consequence, a gene bearing a missense mutation produces a protein product in whirb a single amino acid has been substituted for another, as in the classic example of the human genetic disease sickle cell anemia, in which glutamate 6 "m the p-globin subunit of hemoglobin has been replaced with a valine.

A more drastic effect results from an alteration causing a change to a chain-termination codon, which is known as a nonsense or stop mutation. When a nonsense mutation arises in the middle of a genetic message, an incomplete polypeptide is released from the ribosome owing to premature chain termination. The size of the incomplete polypeptide chain depends on the location of the nonsense mutation. Mutations occurring near the beginning of a gene result in very short polypeptides, whereas mutations near the end produce polypeptide chains of almost normal length. As we saw in Chapter 14, mRNAs that contain a premature stop codon are rapidly degraded in eukaryotic cells by a process known as nonsense-mediated mRNA decay.

The third kind of point mutation is a frameshift mutation. Frameshift mutations are insertions or deletions of one or a small number of base pairs that a ltd the reading frame. Consider e tandem repeat of the sequence GClJ in a Frame thai would be read as a series of alanine codons (the codons are artificially set apart from each other by a gap for clarity but are, of course, contiguous in a real messenger RNA):

Ala Ala Ala Ala Ala Ala Ala Ala

5'-GCU GCU GCU GCU GCU GCU OCU GCU-3'

Now imagine the insertion of an A in the message, thereby generating a serine corlon (AGC) at the site of the insertion. The resulting frame-shift causes triplets downstream of the insertion to be read as cysteines:

Ala Ala Ser Cys Cys Cys Cys Cys

5'-GCU GCU AGC UGC UGC UGC UGC UGC-3'

Thus, the insertion (or for that matter the deletion) of a single base drastically alters the coding capacity of the message not only at the site of the insertion but for the remainder of the messenger as well. Likewise, the insertion (or deletion) of two bases would have the effect of throwing the entire coding sequence, at and downstream of the insertions, into a different reading frame.

Finally, consider the instructive case of an insertion of three extra bases at nearby positions in a message. It is obvious that the stretch of message, at and between the three insertions, will be drastically altered. But because the code is read in units of three, messenger RNA downstream of the three inserted bases will be in its proper reading frame and hence, completely unaltered:

Ala Ala Ser Cys Met Leu Mis Ala Ala Ala 5"-GCU GCU AGC UGC AUG CUG CAU GCU GCU GCU-3'

Genetic Proof that the Code Is Read in Units of Three

The preceding example is the logic of a classic experiment by Francis Oick, Sydney Brenner, and their coworkers, involving bacteriophage T4 that established that the code is read in units of three and did so purely on the basis of a gcnetic argument (that is, without any biochemical or molecular evidence). Genetic crosses were carried out to create a mutant phage harboring three inferred single base pair insertion mutations at nearby positions in a single gene. Of course, the three insertions would have scrambled a short stretch of codons but the protein encoded by the gene in question (called ril) was able to tolerate the local alteration to its amino acid sequence. This finding indicated that the overall coding capacity of the gene had been chiefly left unaltered despite the presence of three mutations, each of which, alone, or any two of which alone, would have drastically altered the reading frame of the gene's message (and rendered its protein product inactive). Because the gene could tolerate three insertions but not one or two (or, for that matter, four), the genetic code must be read in units of tliree. See Chapters 2 and 21 for a discussion of the historic figures who showed that the code is read in units of three, and for a description of the role of bacteriophage T4 as a model system for elucidating the nature of the code.

Was this article helpful?

0 0

Post a comment